Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008600 [exp] 139 / 3e-43 AT1G55190 47 / 7e-07 PRENYLATED RAB ACCEPTOR 1.F2, PRA1 (Prenylated rab acceptor) family protein (.1) Lus10008598 [exp] 119 / 3e-35 AT1G55190 44 / 9e-06 PRENYLATED RAB ACCEPTOR 1.F2, PRA1 (Prenylated rab acceptor) family protein (.1) Lus10042216 [exp] 110 / 1e-31 AT1G04260 43 / 2e-05 PRENYLATED RAB ACCEPTOR 1.D, CAMV movement protein interacting protein 7 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G027900 [exp] 56 / 9e-11 ND /
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10000019 pacid=23164896 polypeptide=Lus10000019 locus=Lus10000019.g ID=Lus10000019.BGIv1.0 annot-version=v1.0 ATGGTGATCATGACTTATGCTTTGTCCCTTTACCTACTCATCTTACGCACATTTCCAGATTCCTATTTCCTTAACAAGCTCGTCGACAAGAGTCTGGTGT TAAGGCTAGTCATGGTTACGACGATGCTTGAACTCATCTTCACTAACGCTGCTGTACATCTTCTCATCACTCTGGCAGCCATCATACCTTTAGTGTTGAT TCACACAGCTTTGTGGCTCGGAGAGCATCTCATAACTGGAAAAAAGGAGTCTGTGAAGAGCTTTCTGCCAATTGAGCAGGAGTTGCCAGCAAGAGAATCA TAA
AA sequence Show only first row Show all	>Lus10000019 pacid=23164896 polypeptide=Lus10000019 locus=Lus10000019.g ID=Lus10000019.BGIv1.0 annot-version=v1.0 MVIMTYALSLYLLILRTFPDSYFLNKLVDKSLVLRLVMVTTMLELIFTNAAVHLLITLAAIIPLVLIHTALWLGEHLITGKKESVKSFLPIEQELPARES

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10000019 [exp]	0	1
AT1G77410		BGAL16	beta-galactosidase 16 (.1)		Lus10018138 [exp]	5.6	0.9026
AT4G12310		CYP706A5	"cytochrome P450, family 706, ...		Lus10024580 [exp]	6.5	0.8921
AT3G11770			Polynucleotidyl transferase, r...		Lus10010357 [exp]	9.3	0.8407
AT3G60330		AHA7	H\(+\)-ATPase 7, H\(+\)-ATPase...		Lus10042904 [exp]	9.6	0.8925
AT1G55200			Protein kinase protein with ad...		Lus10041608 [exp]	10.2	0.8811
AT2G45910			U-box domain-containing protei...		Lus10018835 [exp]	10.2	0.8856
AT5G44120		ATCRA1, CRU1, C...	CRUCIFERINA, RmlC-like cupins ...		Lus10022929 [exp]	12.1	0.8774
AT3G13040	GARP		myb-like HTH transcriptional r...		Lus10028102 [exp]	12.2	0.8782
AT3G21090		ABCG15	ATP-binding cassette G15, ABC-...		Lus10027353 [exp]	14.1	0.8759
AT1G18390			Protein kinase superfamily pro...		Lus10027117 [exp]	17.7	0.8565

Compare expression of checked genes

Lus10000019 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.