Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G07565 44 / 1e-06 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019374 [exp] 139 / 3e-45 AT3G07565 44 / 1e-06 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4) Lus10025582 [exp] 64 / 2e-14 AT3G07565 160 / 3e-50 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4) Lus10025581 [exp] 64 / 8e-14 AT3G07565 155 / 2e-46 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4) Lus10027044 [exp] 61 / 3e-13 AT3G07565 116 / 2e-33 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4) Lus10027045 [exp] 61 / 2e-12 AT2G43400 228 / 1e-71 electron-transfer flavoprotein:ubiquinone oxidoreductase (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G023300 [exp] 62 / 2e-13 AT3G07565 264 / 3e-89 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4) Potri.007G132700 [exp] 52 / 2e-09 AT3G07565 265 / 1e-89 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4) Potri.014G197300 [exp] 40 / 3e-05 AT3G07565 330 / 7e-115 Protein of unknown function (DUF3755) (.1), Protein of unknown function (DUF3755) (.2), Protein of unknown function (DUF3755) (.3), Protein of unknown function (DUF3755) (.4)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10000123 pacid=23180232 polypeptide=Lus10000123 locus=Lus10000123.g ID=Lus10000123.BGIv1.0 annot-version=v1.0 ATGGCAAATCCATCTGGTACGCTCCTTGAGCATCATAATCAGGACTCCACGGCTACCAATAGCAACATGCCTTCTTCTTCGTTCAACGTAAACGAAACAG AAAGCGGGGAGAGCTCGAATTCTGACGCCATATTGAAGCATAATCCTGGAATCTCTAATGATTGGACGGGGAAGGAGCAATCAATACTGGAGGATGGCTT GACGAAGTGA
AA sequence Show only first row Show all	>Lus10000123 pacid=23180232 polypeptide=Lus10000123 locus=Lus10000123.g ID=Lus10000123.BGIv1.0 annot-version=v1.0 MANPSGTLLEHHNQDSTATNSNMPSSSFNVNETESGESSNSDAILKHNPGISNDWTGKEQSILEDGLTK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G07565			Protein of unknown function (D...		Lus10000123 [exp]	0	1
AT1G63060			unknown protein		Lus10000001 [exp]	11.0
AT5G26150			protein kinase family protein ...		Lus10000068 [exp]	91.1
AT5G35110			unknown protein		Lus10000078 [exp]	97.5
AT2G38540		ATLTP1, LP1	ARABIDOPSIS THALIANA LIPID TRA...		Lus10000082 [exp]	100.0
AT2G46490			unknown protein		Lus10000088 [exp]	103.6
AT4G09160			SEC14 cytosolic factor family ...		Lus10000102 [exp]	111.6
AT1G60780		HAP13	HAPLESS 13, Clathrin adaptor c...		Lus10000107 [exp]	114.3
					Lus10000109 [exp]	115.3
					Lus10000134 [exp]	127.9
AT5G17490	GRAS	AtRGL3, RGL3	RGA-like protein 3 (.1)		Lus10000140 [exp]	130.8

Compare expression of checked genes

Lus10000123 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.