Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G05340 125 / 3e-36 Peroxidase superfamily protein (.1) AT5G06720 112 / 3e-31 ATPA2 peroxidase 2 (.1) AT5G06730 109 / 5e-30 Peroxidase superfamily protein (.1) AT5G58400 108 / 7e-30 Peroxidase superfamily protein (.1) AT3G32980 108 / 9e-30 Peroxidase superfamily protein (.1) AT3G49120 102 / 3e-27 PRX34, PRXCB, ATPERX34, PERX34, ATPCB PEROXIDASE 34, ARABIDOPSIS THALIANA PEROXIDASE CB, peroxidase CB (.1) AT5G58390 100 / 7e-27 Peroxidase superfamily protein (.1) AT1G49570 100 / 2e-26 Peroxidase superfamily protein (.1) AT2G38390 99 / 4e-26 Peroxidase superfamily protein (.1) AT3G49110 99 / 4e-26 PRX33, PRXCA, ATPRX33, ATPCA PEROXIDASE 33, peroxidase CA (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10006535 [exp] 194 / 1e-62 AT5G05340 241 / 1e-77 Peroxidase superfamily protein (.1) Lus10006534 [exp] 173 / 7e-55 AT5G05340 399 / 3e-140 Peroxidase superfamily protein (.1) Lus10000346 [exp] 174 / 2e-54 AT5G05340 394 / 8e-137 Peroxidase superfamily protein (.1) Lus10032786 [exp] 131 / 2e-38 AT5G05340 403 / 1e-141 Peroxidase superfamily protein (.1) Lus10003573 [exp] 129 / 7e-38 AT5G05340 397 / 1e-139 Peroxidase superfamily protein (.1) Lus10029062 [exp] 122 / 2e-35 AT5G05340 292 / 1e-98 Peroxidase superfamily protein (.1) Lus10034207 [exp] 122 / 5e-35 AT5G05340 454 / 8e-162 Peroxidase superfamily protein (.1) Lus10009936 [exp] 113 / 1e-31 AT5G05340 361 / 5e-125 Peroxidase superfamily protein (.1) Lus10009934 [exp] 112 / 3e-31 AT5G05340 372 / 5e-130 Peroxidase superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G143200 [exp] 139 / 8e-42 AT5G05340 404 / 5e-142 Peroxidase superfamily protein (.1) Potri.013G083600 [exp] 129 / 1e-37 AT5G05340 483 / 2e-173 Peroxidase superfamily protein (.1) Potri.013G156500 [exp] 119 / 7e-34 AT5G05340 441 / 1e-156 Peroxidase superfamily protein (.1) Potri.013G156800 [exp] 117 / 5e-33 AT5G05340 345 / 7e-119 Peroxidase superfamily protein (.1) Potri.013G154400 [exp] 109 / 3e-30 AT5G05340 363 / 3e-126 Peroxidase superfamily protein (.1) Potri.013G156400 [exp] 109 / 8e-30 AT5G05340 412 / 1e-144 Peroxidase superfamily protein (.1) Potri.003G214700 [exp] 108 / 2e-29 AT5G06720 459 / 5e-163 peroxidase 2 (.1) Potri.003G214800 [exp] 107 / 3e-29 AT5G06720 451 / 5e-160 peroxidase 2 (.1) Potri.003G215001 [exp] 106 / 7e-29 AT5G06720 389 / 1e-135 peroxidase 2 (.1) Potri.016G132900 [exp] 105 / 1e-28 AT5G05340 350 / 6e-121 Peroxidase superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0617 [flax] [poplar] Peroxidase PF00141 [flax] [poplar] peroxidase Peroxidase
Representative CDS sequence Show only first row Show all	>Lus10000626 pacid=23147720 polypeptide=Lus10000626 locus=Lus10000626.g ID=Lus10000626.BGIv1.0 annot-version=v1.0 ATGGCTTATTCCTTTGATAATAAGTCCTCGTTCGTAACTCTCTTCGTTATTGTACTGTCGGTCCTGGCCTCTAGCAGTAACGGCCAACTGGCTGGGAACT TCTATGCAAGAACGTGTCCTAACGTTCAAGGCATCGTCCGGGGTGCGATGAGGGAAGCTGTTAATAGAGAGCCCCGCCTCGGTGCTTCTATCCTTCGCTT GTTCTTCCACGACTGTTTCGTCAATGGATGCGACGGGTCTATTTTGCTCGATGACACGTCAACATTTACGGGGGAGAAGAACGCAATTCCGAATCGGAAC TCAGCTAGAGGAACGCATCTAGAGCGTTTGTAA
AA sequence Show only first row Show all	>Lus10000626 pacid=23147720 polypeptide=Lus10000626 locus=Lus10000626.g ID=Lus10000626.BGIv1.0 annot-version=v1.0 MAYSFDNKSSFVTLFVIVLSVLASSSNGQLAGNFYARTCPNVQGIVRGAMREAVNREPRLGASILRLFFHDCFVNGCDGSILLDDTSTFTGEKNAIPNRN SARGTHLERL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G05340			Peroxidase superfamily protein...		Lus10000626 [exp]	0	1
AT4G26200		ACS7, ATACS7	1-amino-cyclopropane-1-carboxy...		Lus10008579 [exp]	10.1	0.7812
AT3G22800			Leucine-rich repeat (LRR) fami...		Lus10039363 [exp]	19.8	0.7680
					Lus10024617 [exp]	28.8	0.6814
AT4G26010			Peroxidase superfamily protein...		Lus10005679 [exp]	35.0	0.7641
AT1G65890		AAE12	acyl activating enzyme 12 (.1)		Lus10010956 [exp]	36.1	0.7437
AT5G05340			Peroxidase superfamily protein...		Lus10000625 [exp]	48.6	0.7488
AT4G34940		ARO1	armadillo repeat only 1 (.1)		Lus10005065 [exp]	50.1	0.6438
AT2G36570			Leucine-rich repeat protein ki...		Lus10018255 [exp]	50.4	0.7151
AT1G24020		MLP423	MLP-like protein 423 (.1.2)		Lus10029182 [exp]	50.6	0.6943
AT2G05940		RIPK	RPM1-induced protein kinase, P...		Lus10008110 [exp]	54.8	0.7376

Compare expression of checked genes

Lus10000626 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.