Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G28085 68 / 8e-16 SAUR-like auxin-responsive protein family (.1) AT3G09870 68 / 1e-15 SAUR-like auxin-responsive protein family (.1) AT3G12830 58 / 1e-11 SAUR-like auxin-responsive protein family (.1) AT1G56150 54 / 1e-10 SAUR-like auxin-responsive protein family (.1) AT1G19830 54 / 3e-10 SAUR-like auxin-responsive protein family (.1) AT1G79130 53 / 7e-10 SAUR-like auxin-responsive protein family (.1) AT2G21220 52 / 9e-10 SAUR-like auxin-responsive protein family (.1) AT1G19840 53 / 1e-09 SAUR-like auxin-responsive protein family (.1) AT1G20470 53 / 1e-09 SAUR-like auxin-responsive protein family (.1) AT1G16510 53 / 1e-09 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10023011 [exp] 147 / 2e-47 AT3G09870 59 / 1e-12 SAUR-like auxin-responsive protein family (.1) Lus10026532 [exp] 137 / 9e-43 AT3G09870 64 / 3e-14 SAUR-like auxin-responsive protein family (.1) Lus10021435 [exp] 83 / 3e-21 AT2G28085 108 / 4e-31 SAUR-like auxin-responsive protein family (.1) Lus10004014 [exp] 82 / 5e-21 AT3G09870 101 / 1e-28 SAUR-like auxin-responsive protein family (.1) Lus10030263 [exp] 82 / 9e-21 AT3G09870 100 / 4e-28 SAUR-like auxin-responsive protein family (.1) Lus10026531 [exp] 82 / 9e-21 AT3G09870 89 / 7e-24 SAUR-like auxin-responsive protein family (.1) Lus10016129 [exp] 81 / 2e-20 AT2G28085 115 / 4e-34 SAUR-like auxin-responsive protein family (.1) Lus10016130 [exp] 79 / 7e-20 AT2G28085 111 / 2e-32 SAUR-like auxin-responsive protein family (.1) Lus10013819 [exp] 79 / 1e-19 AT3G09870 92 / 7e-25 SAUR-like auxin-responsive protein family (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G092400 [exp] 98 / 3e-27 AT3G09870 108 / 8e-32 SAUR-like auxin-responsive protein family (.1) Potri.006G125100 [exp] 91 / 2e-24 AT3G09870 103 / 2e-29 SAUR-like auxin-responsive protein family (.1) Potri.010G226400 [exp] 80 / 2e-20 AT2G28085 51 / 3e-09 SAUR-like auxin-responsive protein family (.1) Potri.006G278100 [exp] 60 / 3e-12 AT2G24400 179 / 5e-58 SAUR-like auxin-responsive protein family (.1) Potri.005G237000 [exp] 59 / 6e-12 AT1G75590 200 / 4e-67 SAUR-like auxin-responsive protein family (.1) Potri.002G024500 [exp] 58 / 2e-11 AT1G75590 194 / 1e-64 SAUR-like auxin-responsive protein family (.1) Potri.004G164300 [exp] 57 / 2e-11 AT5G10990 170 / 3e-55 SAUR-like auxin-responsive protein family (.1) Potri.002G057500 [exp] 55 / 7e-11 AT3G12830 64 / 2e-14 SAUR-like auxin-responsive protein family (.1) Potri.008G003900 [exp] 55 / 2e-10 AT2G24400 110 / 1e-31 SAUR-like auxin-responsive protein family (.1) Potri.010G253800 [exp] 55 / 4e-10 AT2G24400 142 / 4e-43 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [flax] [poplar] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Lus10001397 pacid=23169887 polypeptide=Lus10001397 locus=Lus10001397.g ID=Lus10001397.BGIv1.0 annot-version=v1.0 ATGCCTCGAAGAATGGGAGATGGGTCATTGATGCTGATGAAGATAATGAAGATCATCTATAAGCAGTTTATGTTAGAGAGTTCTGATGATGTCTGCGATG ATCTGGAACGATCATCGGACAAGCTTCCTGCGGATGTGAAAGAGGGATATTTCGTCGTCTGTGCTGTAAATGATGGTGAACCTAAGAGGTTCATTATCAG GCTTGATTACCTAGCTCACCCAGGCTTCGTGAACCTACTTGAATTGGCTGCTGAAGAATTCGGGCTCCGACAAGGTGGAGTGCTTTCTGTTCCTTGCAGG TCTGTTGATCTCCAAAGGATTCTTGGAAACTGGAGAAAGGGAGCTCGTAACGGTACTGGGTGGTTCTCGCAGTAA
AA sequence Show only first row Show all	>Lus10001397 pacid=23169887 polypeptide=Lus10001397 locus=Lus10001397.g ID=Lus10001397.BGIv1.0 annot-version=v1.0 MPRRMGDGSLMLMKIMKIIYKQFMLESSDDVCDDLERSSDKLPADVKEGYFVVCAVNDGEPKRFIIRLDYLAHPGFVNLLELAAEEFGLRQGGVLSVPCR SVDLQRILGNWRKGARNGTGWFSQ

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G28085			SAUR-like auxin-responsive pro...		Lus10001397 [exp]	0	1
AT4G23310		CRK23	cysteine-rich RLK (RECEPTOR-li...		Lus10031581 [exp]	7.7	0.8512
AT2G16710			Iron-sulphur cluster biosynthe...		Lus10017048 [exp]	9.3	0.8034
AT5G15020		SNL2	SIN3-like 2 (.1.2)		Lus10014505 [exp]	13.6	0.8676
AT2G16860			GCIP-interacting family protei...		Lus10027466 [exp]	14.7	0.8185
AT1G56140			Leucine-rich repeat transmembr...		Lus10010927 [exp]	16.5	0.8254
AT1G59077			unknown protein		Lus10022089 [exp]	18.0	0.8394
AT1G24440			RING/U-box superfamily protein...		Lus10006448 [exp]	18.7	0.7866
AT5G56260			Ribonuclease E inhibitor RraA/...		Lus10027126 [exp]	20.1	0.8624
AT5G24800	bZIP	BZO2H2, ATBZIP9	BASIC LEUCINE ZIPPER O2 HOMOLO...		Lus10026973 [exp]	23.9	0.8417
AT1G59453			B-block binding subunit of TFI...		Lus10000370 [exp]	27.5	0.8317

Compare expression of checked genes

Lus10001397 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.