Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G23350 48 / 1e-07 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10002420 [exp] 219 / 4e-73 AT3G36659 54 / 2e-08 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1) Lus10025021 [exp] 133 / 2e-38 AT3G14300 63 / 2e-10 A. THALIANA PECTIN METHYLESTERASE 26, pectinesterase family protein (.1) Lus10010002 [exp] 131 / 5e-37 AT3G14300 / A. THALIANA PECTIN METHYLESTERASE 26, pectinesterase family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G119200 [exp] 67 / 1e-14 AT1G02550 97 / 2e-24 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1) Potri.014G119400 [exp] 64 / 5e-13 AT1G02550 78 / 2e-16 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1) Potri.002G194800 [exp] 59 / 2e-11 AT1G02550 87 / 2e-20 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1) Potri.002G194900 [exp] 58 / 3e-11 AT1G02550 87 / 2e-20 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1) Potri.002G195000 [exp] 57 / 1e-10 AT1G02550 76 / 3e-16 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF04043 [flax] [poplar] PMEI Plant invertase/pectin methylesterase inhibitor
Representative CDS sequence Show only first row Show all	>Lus10001448 pacid=23161041 polypeptide=Lus10001448 locus=Lus10001448.g ID=Lus10001448.BGIv1.0 annot-version=v1.0 ATGGAGATCAAGGCAATTAAAAAGGGGTTTGTAACAGCAATTGCGAAGGCAAAGAAGATGAGGAAGAATACAAACCGGAAGATGGATAAGAGCACAATTG ATTCATGTGTCGAGAACTTCAGTAGTGGCCTCACGGATCTTGAAAATGCTATAGATGCGATAAATGACAACGATCGATACTCATTACAGATCATGTTGAG TTCCATTCTAACATACATTTCAACGTGTGAGGATGCAATAGGCGAGGATCAAGAATCTTCCCTCCCAAGCATAACACAAATGGAACACAAGTTGACAAAC CTTGTTACCAATTGCATGGACTTGGCCGACCAATTTAATTGA
AA sequence Show only first row Show all	>Lus10001448 pacid=23161041 polypeptide=Lus10001448 locus=Lus10001448.g ID=Lus10001448.BGIv1.0 annot-version=v1.0 MEIKAIKKGFVTAIAKAKKMRKNTNRKMDKSTIDSCVENFSSGLTDLENAIDAINDNDRYSLQIMLSSILTYISTCEDAIGEDQESSLPSITQMEHKLTN LVTNCMDLADQFN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G23350			Plant invertase/pectin methyle...		Lus10001448 [exp]	0	1

Compare expression of checked genes

Lus10001448 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.