Lus10001658 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G48020 86 / 3e-21 ATPMEI1 ARABIDOPSIS THALIANA PECTIN METHYLESTERASE INHIBITOR 1, pectin methylesterase inhibitor 1 (.1)
AT3G17220 83 / 4e-20 ATPMEI2 pectin methylesterase inhibitor 2 (.1)
AT4G02250 54 / 2e-09 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT1G50340 52 / 8e-09 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT2G31430 51 / 4e-08 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT1G50325 50 / 6e-08 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT5G46960 50 / 6e-08 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT1G09360 44 / 2e-05 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT5G46950 42 / 4e-05 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
AT5G38610 41 / 0.0002 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10017345 301 / 4e-106 AT3G17220 89 / 1e-22 pectin methylesterase inhibitor 2 (.1)
Lus10017347 227 / 1e-76 AT3G17220 81 / 2e-19 pectin methylesterase inhibitor 2 (.1)
Lus10017346 181 / 1e-58 AT3G17220 79 / 8e-19 pectin methylesterase inhibitor 2 (.1)
Lus10041650 160 / 3e-50 AT1G48020 85 / 4e-21 ARABIDOPSIS THALIANA PECTIN METHYLESTERASE INHIBITOR 1, pectin methylesterase inhibitor 1 (.1)
Lus10001659 157 / 4e-49 AT1G48020 51 / 3e-08 ARABIDOPSIS THALIANA PECTIN METHYLESTERASE INHIBITOR 1, pectin methylesterase inhibitor 1 (.1)
Lus10023114 84 / 1e-20 AT3G17220 60 / 2e-11 pectin methylesterase inhibitor 2 (.1)
Lus10008201 62 / 2e-12 AT4G02250 113 / 3e-32 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10019498 61 / 1e-11 AT5G46970 87 / 1e-21 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Lus10001464 58 / 9e-11 AT4G02250 112 / 1e-31 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.014G044100 63 / 1e-12 AT5G46940 111 / 3e-31 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.004G016500 57 / 2e-10 AT4G02250 73 / 2e-16 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.006G134900 55 / 1e-09 AT5G64620 76 / 2e-17 cell wall / vacuolar inhibitor of fructosidase 2 (.1)
Potri.001G127500 55 / 1e-09 AT4G02250 98 / 3e-26 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.002G191500 54 / 3e-09 AT2G31430 104 / 2e-28 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.010G209800 51 / 3e-08 AT5G64620 93 / 5e-24 cell wall / vacuolar inhibitor of fructosidase 2 (.1)
Potri.003G086600 48 / 4e-07 AT5G38610 123 / 2e-35 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.003G086500 48 / 7e-07 AT5G46940 119 / 6e-34 Plant invertase/pectin methylesterase inhibitor superfamily protein (.1)
Potri.002G066300 47 / 1e-06 ND /
Potri.008G013400 39 / 0.0006 AT5G64620 66 / 8e-14 cell wall / vacuolar inhibitor of fructosidase 2 (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF04043 PMEI Plant invertase/pectin methylesterase inhibitor
Representative CDS sequence
>Lus10001658 pacid=23154053 polypeptide=Lus10001658 locus=Lus10001658.g ID=Lus10001658.BGIv1.0 annot-version=v1.0
ATGGCGACATCGTTCGTATGTCTCTCTGTCGCGGTGATCCTCCTCCTGTCCCAAACCCTCCCTTATGTGGCGGCTGACCTTCGCATAAGGTTGGCCCCAC
CGGACATCGCCGCGATATGCGACAAGAGCATCGACCGCAACTTCTGCCTCAACTTCCTCAAGACGACGCCCGGGATCTCGACCGCCAATCTCAAGGGTGC
CGGTCTCATCACCCTGGAGGCCGCACGTGGCGAAGCGGCCGACACAAAGAAGTACATCAAAAATTTGTTGGGAAAGGCGGCGGACCCCAAGACGAAGGAG
AGCTACAAGTCGTGCCTGAGCAGTTACGACGATGCGGTGGACAACATCGAGACGGCCAAGGCGTCGTTGAACAGCGGCGACTACAACGGTGCTAACATCC
AAGCCTCAGCGGCTCAGACTGATGCCGATGATTGCAAGGGTGTCAAGGGATCGGAGCTGCTGGGTAGGAACCGGCATTTGATTAAGGTTCTTGGGATCGT
TTTGATCATTGCCAACAAGTTGGTCGGACGTTGA
AA sequence
>Lus10001658 pacid=23154053 polypeptide=Lus10001658 locus=Lus10001658.g ID=Lus10001658.BGIv1.0 annot-version=v1.0
MATSFVCLSVAVILLLSQTLPYVAADLRIRLAPPDIAAICDKSIDRNFCLNFLKTTPGISTANLKGAGLITLEAARGEAADTKKYIKNLLGKAADPKTKE
SYKSCLSSYDDAVDNIETAKASLNSGDYNGANIQASAAQTDADDCKGVKGSELLGRNRHLIKVLGIVLIIANKLVGR

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G48020 ATPMEI1 ARABIDOPSIS THALIANA PECTIN ME... Lus10001658 0 1
Lus10003941 1.0 1.0000
AT1G01280 CYP703A2 "cytochrome P450, family 703, ... Lus10010119 1.4 1.0000
AT5G39130 RmlC-like cupins superfamily p... Lus10015129 1.7 1.0000
AT5G01180 ATPTR5 ARABIDOPSIS THALIANA PEPTIDE T... Lus10017177 2.0 1.0000
Lus10017294 2.2 1.0000
AT1G29050 TBL38 TRICHOME BIREFRINGENCE-LIKE 38... Lus10039560 2.4 1.0000
AT4G04960 Concanavalin A-like lectin pro... Lus10039837 2.6 1.0000
AT1G04110 SDD1 STOMATAL DENSITY AND DISTRIBUT... Lus10027892 2.8 1.0000
Lus10001546 4.8 0.7816
AT3G18990 B3 REM39, VRN1 REDUCED VERNALIZATION RESPONSE... Lus10025913 7.7 0.7274

Lus10001658 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.