Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G19170 42 / 3e-05 SLP3 subtilisin-like serine protease 3 (.1) AT4G30020 39 / 0.0001 PA-domain containing subtilase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10015559 [exp] 39 / 0.0002 AT1G62340 903 / 0.0 ABNORMAL LEAF-SHAPE 1, ABNORMAL LEAF-SHAPE, PA-domain containing subtilase family protein (.1) Lus10001310 [exp] 39 / 0.0002 AT4G30020 1258 / 0.0 PA-domain containing subtilase family protein (.1) Lus10006973 [exp] 39 / 0.0002 AT4G30020 1334 / 0.0 PA-domain containing subtilase family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G092700 [exp] 149 / 3e-48 AT2G19170 51 / 8e-09 subtilisin-like serine protease 3 (.1) Potri.003G138800 [exp] 141 / 4e-45 AT2G19170 49 / 4e-08 subtilisin-like serine protease 3 (.1) Potri.018G143400 [exp] 41 / 3e-05 AT4G30020 1338 / 0.0 PA-domain containing subtilase family protein (.1) Potri.006G076200 [exp] 40 / 0.0001 AT2G19170 1342 / 0.0 subtilisin-like serine protease 3 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10001901 pacid=23157115 polypeptide=Lus10001901 locus=Lus10001901.g ID=Lus10001901.BGIv1.0 annot-version=v1.0 ATGGCAAGTACTCATACGGAAACTCACGAGCTCTACTTTGTGTTCATGAACTACGATCCTCAGTACGAGCGCCTTCGAGCCGATCGGACGAAGCGAGGAG CGCATCAGCTGGACGTGTATCTGAGCAAGAAGCACGATGGGTTGCTGAGTGCCACTTTAGAGGTCGGGACCTACAACAAGACCTGCTCTCTCGTCATCGT TGATGGTTTTGCCGTCGAAATCACTCAAGATCAGGCATGTGCCAATGTGCTTCGATCCGCTGACGGAGTGAGGCTTGTGGAGAAGAATCAAGAGCTTCCT AATTAG
AA sequence Show only first row Show all	>Lus10001901 pacid=23157115 polypeptide=Lus10001901 locus=Lus10001901.g ID=Lus10001901.BGIv1.0 annot-version=v1.0 MASTHTETHELYFVFMNYDPQYERLRADRTKRGAHQLDVYLSKKHDGLLSATLEVGTYNKTCSLVIVDGFAVEITQDQACANVLRSADGVRLVEKNQELP N

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10001901 [exp]	0	1
AT5G43190			Galactose oxidase/kelch repeat...		Lus10007740 [exp]	16.4	0.7771
AT1G17650		GR2, GLYR2	glyoxylate reductase 2 (.1)		Lus10015612 [exp]	17.3	0.7457
AT1G18440			Peptidyl-tRNA hydrolase family...		Lus10042977 [exp]	21.0	0.7223
					Lus10023751 [exp]	25.3	0.7351
AT4G00910			Aluminium activated malate tra...		Lus10001528 [exp]	27.8	0.7800
					Lus10005512 [exp]	31.3	0.6854
AT1G13290	C2H2ZnF	WIP6, DOT5	WIP domain protein 6, DEFECTIV...		Lus10035044 [exp]	32.2	0.6987
AT2G41950			unknown protein		Lus10016243 [exp]	43.3	0.7647
AT5G66530			Galactose mutarotase-like supe...		Lus10041758 [exp]	45.6	0.7086
AT3G53270			Small nuclear RNA activating c...		Lus10001478 [exp]	48.9	0.7625

Compare expression of checked genes

Lus10001901 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.