Lus10002087 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10003852 107 / 4e-31 ND /
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10002087 pacid=23151630 polypeptide=Lus10002087 locus=Lus10002087.g ID=Lus10002087.BGIv1.0 annot-version=v1.0
ATGGGGGGTTGCGCCACCAAGCCAAAGGTCGCCAAAGACCAGAATCTCCCTGCGCCGGCGCCTGAGAAGGGAGATGAGCTAGCCACGTCCACCGCCGTGG
ATATGACGGCAGTGGAGGAGAAGGAGGTTGTGGTCGTCGGAGGTGAAGAAGGAGAGAAGAAGAAAGGTGACGGTGAGACCCTCAGTCAACAGCTGTTGAA
GGAGAGCACGGAAGAAGAAACAGAGACCATCGTAGAAGACGGTAACAAGTCGTCGTTGCCGGAAGCAGCGGTGGAAGTGACGACGACGGAGGCCGGGAAA
GGTGAGGCTCCGGAGGCGGCAGTGGCTGAAGTGGTGAAGGAGGCCGTTGTTGTAAGTTGA
AA sequence
>Lus10002087 pacid=23151630 polypeptide=Lus10002087 locus=Lus10002087.g ID=Lus10002087.BGIv1.0 annot-version=v1.0
MGGCATKPKVAKDQNLPAPAPEKGDELATSTAVDMTAVEEKEVVVVGGEEGEKKKGDGETLSQQLLKESTEEETETIVEDGNKSSLPEAAVEVTTTEAGK
GEAPEAAVAEVVKEAVVVS

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10002087 0 1
AT4G06536 SPla/RYanodine receptor (SPRY)... Lus10010045 1.0 0.9770
AT4G22990 Major Facilitator Superfamily ... Lus10015852 2.6 0.9373
AT3G56230 BTB/POZ domain-containing prot... Lus10010216 3.0 0.9532
Lus10003852 3.2 0.9330
AT5G05320 FAD/NAD(P)-binding oxidoreduct... Lus10025068 3.2 0.9599
AT2G42610 LSH10 LIGHT SENSITIVE HYPOCOTYLS 10,... Lus10029838 3.5 0.9314
AT4G13620 AP2_ERF Integrase-type DNA-binding sup... Lus10016669 5.5 0.9088
AT3G55230 Disease resistance-responsive ... Lus10003301 5.7 0.9443
AT5G61830 NAD(P)-binding Rossmann-fold s... Lus10001968 6.5 0.9377
AT2G30210 LAC3 laccase 3 (.1) Lus10026401 6.5 0.9284

Lus10002087 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.