Plant FIBer expression Database

Lus10002259 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G14010 47 / 3e-07 RALFL32 ralf-like 32 (.1)
AT2G34825 44 / 1e-06 RALFL20 RALF-like 20 (.1)
AT2G32885 40 / 2e-05 Rapid alkalinization factor (RALF) family protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10000923
[exp]
99 / 4e-27 AT2G32885 50 / 4e-09 Rapid alkalinization factor (RALF) family protein (.1)
Lus10002260
[exp]
49 / 2e-07 AT4G11510 47 / 8e-07 ralf-like 28 (.1)
Lus10002261
[exp]
49 / 3e-07 AT4G11510 / ralf-like 28 (.1)
Lus10006213
[exp]
42 / 2e-05 AT1G35467 42 / 3e-06 RALF-like 5 (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.017G059800
[exp]
39 / 0.0002 AT4G14010 70 / 1e-16 ralf-like 32 (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF05498 RALF Rapid ALkalinization Factor (RALF)
Representative CDS sequence
>Lus10002259 pacid=23153439 polypeptide=Lus10002259 locus=Lus10002259.g ID=Lus10002259.BGIv1.0 annot-version=v1.0
ATGTCGAAGATGTTGAAAATTGTCGCTGTTTCTTCTATTGTAGTAATTTTATTGTGTGTAGTCACTGTGAGAGAAACGGAAGCGAAGGTAATCGAGTATC
CGGCTATAAGGAAAAACAACCCAAAATGTCCAGGCAGCGCCACGGGACAATGCGCACCAAAACCGGCTAATCCATATGAAAGAGGTTGCAGCCCGAACAC
CGGATGTCGTGGGGACGAAGTTGAAGAAGAGGAGAATAATAAGGAACGAGAGGAAGAAGCCAAGAAGGCGACAGGCAGCGTGGAAGAAGACGAGAGAAAA
GATGACGATGAGGAACGCAATAACGAGAAAGAGGAACGTGAAAAGAAGGACCGTAAAAGAAGCAGCAGCAAAGATAAAAAGAAGGAGAAAGATGAGGCGA
AGAAGAACGAAGAGAACGAGCTTTGA
AA sequence
>Lus10002259 pacid=23153439 polypeptide=Lus10002259 locus=Lus10002259.g ID=Lus10002259.BGIv1.0 annot-version=v1.0
MSKMLKIVAVSSIVVILLCVVTVRETEAKVIEYPAIRKNNPKCPGSATGQCAPKPANPYERGCSPNTGCRGDEVEEEENNKEREEEAKKATGSVEEDERK
DDDEERNNEKEEREKKDRKRSSSKDKKKEKDEAKKNEENEL

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT2G34825 RALFL20 RALF-like 20 (.1) Lus10002259
[exp]
0 1
AT5G02910 F-box/RNI-like superfamily pro... Lus10000727
[exp]
4.4 0.8502
Lus10004437
[exp]
6.2 0.8502
AT2G24370 Protein kinase protein with ad... Lus10027593
[exp]
7.5 0.8502
AT3G08030 Protein of unknown function, D... Lus10029502
[exp]
8.7 0.8502
AT1G30700 FAD-binding Berberine family p... Lus10031080
[exp]
9.7 0.8502
AT3G18170 Glycosyltransferase family 61 ... Lus10032454
[exp]
10.7 0.8502
AT2G26490 Transducin/WD40 repeat-like su... Lus10032868
[exp]
11.5 0.8502
Lus10021739
[exp]
12.3 0.8502
Lus10039674
[exp]
13.1 0.8502
AT1G30920 F-box family protein (.1) Lus10006734
[exp]
14.1 0.8332

Lus10002259 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.