Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G71090 99 / 2e-26 Auxin efflux carrier family protein (.1) AT5G01990 62 / 4e-13 Auxin efflux carrier family protein (.1) AT1G20925 49 / 2e-08 Auxin efflux carrier family protein (.1) AT1G76520 46 / 2e-07 Auxin efflux carrier family protein (.1.2) AT1G76530 46 / 2e-07 Auxin efflux carrier family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10004059 [exp] 134 / 2e-39 AT1G71090 234 / 3e-72 Auxin efflux carrier family protein (.1) Lus10016704 [exp] 97 / 4e-26 AT1G71090 481 / 2e-170 Auxin efflux carrier family protein (.1) Lus10036000 [exp] 97 / 6e-26 AT1G71090 486 / 3e-172 Auxin efflux carrier family protein (.1) Lus10003240 [exp] 49 / 3e-08 AT5G01990 610 / 0.0 Auxin efflux carrier family protein (.1) Lus10035610 [exp] 46 / 3e-07 AT5G01990 605 / 0.0 Auxin efflux carrier family protein (.1) Lus10025166 [exp] 44 / 1e-06 AT1G76520 455 / 8e-160 Auxin efflux carrier family protein (.1.2) Lus10004287 [exp] 41 / 1e-05 AT1G20925 430 / 1e-148 Auxin efflux carrier family protein (.1) Lus10019229 [exp] 39 / 7e-05 AT5G23490 667 / 0.0 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G122400 [exp] 111 / 6e-31 AT1G71090 580 / 0.0 Auxin efflux carrier family protein (.1) Potri.004G093200 [exp] 108 / 1e-29 AT1G71090 513 / 1e-180 Auxin efflux carrier family protein (.1) Potri.008G127700 [exp] 105 / 1e-28 AT1G71090 660 / 0.0 Auxin efflux carrier family protein (.1) Potri.010G115200 [exp] 105 / 2e-28 AT1G71090 607 / 0.0 Auxin efflux carrier family protein (.1) Potri.006G112200 [exp] 68 / 4e-15 AT5G01990 602 / 0.0 Auxin efflux carrier family protein (.1) Potri.016G141700 [exp] 67 / 1e-14 AT5G01990 622 / 0.0 Auxin efflux carrier family protein (.1) Potri.001G456400 [exp] 50 / 1e-08 AT1G76520 419 / 1e-145 Auxin efflux carrier family protein (.1.2) Potri.002G003500 [exp] 45 / 4e-07 AT1G20925 499 / 4e-176 Auxin efflux carrier family protein (.1) Potri.011G145600 [exp] 45 / 5e-07 AT1G76520 368 / 2e-125 Auxin efflux carrier family protein (.1.2) Potri.001G456300 [exp] 45 / 5e-07 AT1G76520 382 / 5e-131 Auxin efflux carrier family protein (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0064 [flax] [poplar] CPA_AT PF03547 [flax] [poplar] Mem_trans Membrane transport protein
Representative CDS sequence Show only first row Show all	>Lus10002281 pacid=23171948 polypeptide=Lus10002281 locus=Lus10002281.g ID=Lus10002281.BGIv1.0 annot-version=v1.0 ATGGGGCTGCTGGTGGGCGGAGACCAGCTGTACAAGTTCGTGTTGCTGTTGCAGTACGCGACGCCGAGCGCTATTCTACTGGGGGCGGTGGCGAGCTTGA GAGGGTACGCGGTGAAGGAAGCGTCGGCGTTGCTGTTCTGGCAGCATATCTGTGCAGTGGGATCTCTTTGCTTGTATGTTGTCGTCTTCTTCAAGCTCTT GCTTTCCTACACTTGA
AA sequence Show only first row Show all	>Lus10002281 pacid=23171948 polypeptide=Lus10002281 locus=Lus10002281.g ID=Lus10002281.BGIv1.0 annot-version=v1.0 MGLLVGGDQLYKFVLLLQYATPSAILLGAVASLRGYAVKEASALLFWQHICAVGSLCLYVVVFFKLLLSYT

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G71090			Auxin efflux carrier family pr...		Lus10002281 [exp]	0	1
AT4G14465	AT-hook	AHL20	AT-hook motif nuclear-localize...		Lus10022010 [exp]	12.4	0.6332
AT1G71090			Auxin efflux carrier family pr...		Lus10002280 [exp]	156.5	0.5631
AT2G01060	GARP		myb-like HTH transcriptional r...		Lus10039124 [exp]	165.6	0.5940

Compare expression of checked genes

Lus10002281 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.