Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G55805 119 / 1e-35 BolA-like family protein (.1) AT4G26500 118 / 4e-33 SUFE1, EMB1374, CPSUFE, ATSUFE SULFUR E 1, MBRYO DEFECTIVE 1374, ARABIDOPSIS THALIANA SULFUR E, chloroplast sulfur E (.1) AT5G17560 51 / 5e-09 BolA-like family protein (.1) AT5G09830 46 / 1e-07 BolA-like family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10026101 [exp] 203 / 1e-69 AT4G26500 124 / 1e-37 SULFUR E 1, MBRYO DEFECTIVE 1374, ARABIDOPSIS THALIANA SULFUR E, chloroplast sulfur E (.1) Lus10015605 [exp] 122 / 2e-34 AT4G26500 387 / 2e-133 SULFUR E 1, MBRYO DEFECTIVE 1374, ARABIDOPSIS THALIANA SULFUR E, chloroplast sulfur E (.1) Lus10032905 [exp] 116 / 2e-32 AT4G26500 380 / 4e-131 SULFUR E 1, MBRYO DEFECTIVE 1374, ARABIDOPSIS THALIANA SULFUR E, chloroplast sulfur E (.1) Lus10009527 [exp] 51 / 7e-09 AT5G17560 145 / 2e-44 BolA-like family protein (.1) Lus10020347 [exp] 50 / 1e-08 AT5G17560 158 / 2e-49 BolA-like family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.012G036800 [exp] 166 / 9e-55 AT1G55805 130 / 6e-40 BolA-like family protein (.1) Potri.001G468300 [exp] 118 / 4e-33 AT4G26500 392 / 5e-136 SULFUR E 1, MBRYO DEFECTIVE 1374, ARABIDOPSIS THALIANA SULFUR E, chloroplast sulfur E (.1) Potri.011G165400 [exp] 116 / 2e-32 AT4G26500 404 / 1e-140 SULFUR E 1, MBRYO DEFECTIVE 1374, ARABIDOPSIS THALIANA SULFUR E, chloroplast sulfur E (.1) Potri.013G074100 [exp] 50 / 1e-08 AT5G17560 156 / 6e-49 BolA-like family protein (.1) Potri.001G309200 [exp] 43 / 2e-06 AT5G09830 132 / 4e-42 BolA-like family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF01722 [flax] [poplar] BolA BolA-like protein
Representative CDS sequence Show only first row Show all	>Lus10002318 pacid=23180873 polypeptide=Lus10002318 locus=Lus10002318.g ID=Lus10002318.BGIv1.0 annot-version=v1.0 ATGGGTTCTCGAGCAGCGGCCGCGATTATGTCGAGAGCACAGAGGATTACCACCAAGCTTCAGTCTACGTTGCAAGCGACCGTTCTGGAGGTGGAGGATG TCTCTCGTCAGCACGCAGGCCACGCCGCCATGAAGGGAGATACCGCCGGGGAGACGCATTTCGATGTGAAGATCGTGTCTCCTAAATTCGATGGGCTCAG CCTTGTCAATCGGCACCGCCTCATTTACGATGCGCTGTCGGAGGAGCTCCAATCTGGCCTCCATGCCCTTTCGATCGTTGCCAAGACGCCGGTGGAAATA TCTGCCTCCAAGAAGTAA
AA sequence Show only first row Show all	>Lus10002318 pacid=23180873 polypeptide=Lus10002318 locus=Lus10002318.g ID=Lus10002318.BGIv1.0 annot-version=v1.0 MGSRAAAAIMSRAQRITTKLQSTLQATVLEVEDVSRQHAGHAAMKGDTAGETHFDVKIVSPKFDGLSLVNRHRLIYDALSEELQSGLHALSIVAKTPVEI SASKK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G55805			BolA-like family protein (.1)		Lus10002318 [exp]	0	1
AT4G03600			unknown protein		Lus10039834 [exp]	2.8	0.8658
AT3G13845			unknown protein		Lus10015617 [exp]	4.0	0.8167
AT2G39170			unknown protein		Lus10040608 [exp]	4.0	0.8313
AT5G44000			Glutathione S-transferase fami...		Lus10027233 [exp]	5.1	0.8457
AT1G64810		APO1	ACCUMULATION OF PHOTOSYSTEM ON...		Lus10039122 [exp]	5.2	0.8348
AT1G11930			Predicted pyridoxal phosphate-...		Lus10020039 [exp]	6.0	0.8158
AT1G43850		SEU	SEUSS transcriptional co-regul...		Lus10029753 [exp]	8.1	0.8093
AT3G58090			Disease resistance-responsive ...		Lus10009074 [exp]	8.4	0.8135
AT1G80230			Rubredoxin-like superfamily pr...		Lus10025745 [exp]	9.5	0.7842
AT4G03600			unknown protein		Lus10018599 [exp]	11.2	0.8209

Compare expression of checked genes

Lus10002318 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.