Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G40460 84 / 4e-22 unknown protein AT1G10690 61 / 4e-13 unknown protein AT1G60783 50 / 6e-09 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10022268 [exp] 164 / 5e-54 AT5G40460 96 / 3e-27 unknown protein Lus10006204 [exp] 53 / 3e-10 AT1G60783 77 / 9e-20 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G070000 [exp] 122 / 1e-37 AT5G40460 89 / 3e-24 unknown protein Potri.010G045200 [exp] 81 / 6e-21 AT1G10690 92 / 2e-25 unknown protein Potri.008G187300 [exp] 64 / 2e-14 AT5G40460 97 / 3e-27 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10002514 pacid=23146199 polypeptide=Lus10002514 locus=Lus10002514.g ID=Lus10002514.BGIv1.0 annot-version=v1.0 ATGGGGTTTACGAAGAAGAAGATATCGGATTCCGGCATGGAATCCGACGGGAAGAAATGGGTCATCGCTGGAATCTCAATAAAGTCACTGAAACCCATCA ACACCAAACCCAGAGACAGAGCAAGCCGAGGAGACAACATAGGAGAGGAAGAGGAGCGTTCAACTACGCCGACGGCGAAGGAGGCGAGAATACCGGAGAA ACTGGCTTGCCCTCCGGCGCCGAGGAAGAGACGGCCACCTCCGTCGTCGTCAAGGTGCAACTACACGGTTGCTAGAGAGTTCTTCACTCCGCCTGACCTG GACTCTGTCTTCAAACGCTATGTTGAAAAAGCCAATTGA
AA sequence Show only first row Show all	>Lus10002514 pacid=23146199 polypeptide=Lus10002514 locus=Lus10002514.g ID=Lus10002514.BGIv1.0 annot-version=v1.0 MGFTKKKISDSGMESDGKKWVIAGISIKSLKPINTKPRDRASRGDNIGEEEERSTTPTAKEARIPEKLACPPAPRKRRPPPSSSRCNYTVAREFFTPPDL DSVFKRYVEKAN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G40460			unknown protein		Lus10002514 [exp]	0	1
AT3G62860			alpha/beta-Hydrolases superfam...		Lus10030366 [exp]	6.6	0.7553
AT4G05120		FUR1, ENT3, FLU...	FUDR RESISTANT 1, EQUILIBRATIV...		Lus10018413 [exp]	8.5	0.7758
AT2G37680		PAT3, FRY1, FHY...	unknown protein		Lus10023781 [exp]	15.3	0.7904
AT1G15320			unknown protein		Lus10025746 [exp]	29.9	0.7426
AT2G03270			DNA-binding protein, putative ...		Lus10042360 [exp]	34.3	0.7847
AT5G50410			unknown protein		Lus10017246 [exp]	49.3	0.7157
AT5G58170		GDPDL7, SVL5	Glycerophosphodiester phosphod...		Lus10019605 [exp]	57.5	0.7149
AT4G35190		LOG5	LONELY GUY 5, Putative lysine ...		Lus10025117 [exp]	63.9	0.7035
AT1G49870			unknown protein		Lus10013902 [exp]	102.9	0.7047
AT5G66240			Transducin/WD40 repeat-like su...		Lus10017157 [exp]	109.6	0.7109

Compare expression of checked genes

Lus10002514 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.