Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G40480 66 / 1e-13 EMB3012 embryo defective 3012 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G345100 [exp] 69 / 8e-15 AT5G40480 2192 / 0.0 embryo defective 3012 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10002517 pacid=23146203 polypeptide=Lus10002517 locus=Lus10002517.g ID=Lus10002517.BGIv1.0 annot-version=v1.0 ATGGTAATAGATGTGAACTACGAGCCTGCTGCAAAACCAGTAGCCATCAGCTTCCTCTTTCAAATATTAATATTGGCATTTCTGGCCCTATTGACAATAT GGGCGACTATTACCGTTTTCTGGAAGATAACTGCACCACTGCCATCGCCATCTGTTTATGCCCCTGCTAATGGTAATGGCAATGGAAACAACACTGGTCC TGGCACTCCGGATCGCAGCAGTCCACCTGGATTTTCAGAACGTTCGCCAAGAACGCCTCAGCCTTACATAGAATACATGAGAAGGACGATTGAAGAGACC CCATTTTATAAAAGGGATGCTAGGAGAAGGTTTAACCCGCAGAACACTTACTAG
AA sequence Show only first row Show all	>Lus10002517 pacid=23146203 polypeptide=Lus10002517 locus=Lus10002517.g ID=Lus10002517.BGIv1.0 annot-version=v1.0 MVIDVNYEPAAKPVAISFLFQILILAFLALLTIWATITVFWKITAPLPSPSVYAPANGNGNGNNTGPGTPDRSSPPGFSERSPRTPQPYIEYMRRTIEET PFYKRDARRRFNPQNTY

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G40480		EMB3012	embryo defective 3012 (.1)		Lus10002517 [exp]	0	1
AT4G14720	ZIM	TIFY4B, PPD2	PEAPOD 2, TIFY domain/Divergen...		Lus10014700 [exp]	2.6	0.7288
AT3G24820			BSD domain-containing protein ...		Lus10038170 [exp]	14.3	0.7123
AT4G14805			Bifunctional inhibitor/lipid-t...		Lus10010576 [exp]	28.5	0.5944
AT5G52390			PAR1 protein (.1)		Lus10040702 [exp]	43.7	0.6367
AT5G41610		ATCHX18	cation/H+ exchanger 18, ARABID...		Lus10017541 [exp]	54.6	0.6502
AT4G11410			NAD(P)-binding Rossmann-fold s...		Lus10028781 [exp]	59.9	0.6432
AT3G02125			unknown protein		Lus10032983 [exp]	121.9	0.5908
AT1G75130		CYP721A1	"cytochrome P450, family 721, ...		Lus10010801 [exp]	143.0	0.5934
AT4G12680			unknown protein		Lus10025177 [exp]	171.5	0.5735
AT2G18470		AtPERK4, PERK4	proline-rich extensin-like rec...		Lus10014318 [exp]	188.3	0.5964

Compare expression of checked genes

Lus10002517 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.