Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G65495 47 / 4e-08 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10012729 [exp] 125 / 2e-38 AT5G65495 69 / 2e-16 unknown protein
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10002656 pacid=23168808 polypeptide=Lus10002656 locus=Lus10002656.g ID=Lus10002656.BGIv1.0 annot-version=v1.0 ATGTGCTGCGGACGGCAAAGCTCCTTATCTCCGAGAGATTCAATCCACTGGTCTCGCAACCGCCGATCGCCAGACAACGACGACGACGACGACCATGCTC TGATTGAAGATCTACGAAGTCGGCTGGCGGAGACAGAGGCACGGCTCGAACGCGCCAGAGCTCGGGAAGCTGAGCTGACCCGACGATTGGAAGAGATGAA GCGGTATCTGTCGGTGATGGAGATTCTCGAGTCGTATCTCAAGCGCCAGTTCCACGACCAGCAAGAACGAGTCGCCTGTATATTCTCTTCCATCGCCGCC AAAGTCAAGAGCTTAAATCGGTGA
AA sequence Show only first row Show all	>Lus10002656 pacid=23168808 polypeptide=Lus10002656 locus=Lus10002656.g ID=Lus10002656.BGIv1.0 annot-version=v1.0 MCCGRQSSLSPRDSIHWSRNRRSPDNDDDDDHALIEDLRSRLAETEARLERARAREAELTRRLEEMKRYLSVMEILESYLKRQFHDQQERVACIFSSIAA KVKSLNR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G65495			unknown protein		Lus10002656 [exp]	0	1
AT1G02305			Cysteine proteinases superfami...		Lus10007212 [exp]	2.2	0.9538
AT3G15760			unknown protein		Lus10030098 [exp]	3.5	0.9488
AT5G41810			unknown protein		Lus10001907 [exp]	4.5	0.9524
AT2G37740	C2H2ZnF	ATZFP10, ZFP10	zinc-finger protein 10 (.1)		Lus10024362 [exp]	5.7	0.9487
AT5G41350			RING/U-box superfamily protein...		Lus10032270 [exp]	5.7	0.9466
AT5G47720			Thiolase family protein (.1.2....		Lus10038749 [exp]	5.9	0.9467
AT2G01490			phytanoyl-CoA dioxygenase (Phy...		Lus10013462 [exp]	6.6	0.9446
AT5G18150			Methyltransferase-related prot...		Lus10020287 [exp]	6.9	0.9396
AT3G07560		APM2, PEX13	ABERRANT PEROXISOME MORPHOLOGY...		Lus10012306 [exp]	6.9	0.9480
AT1G54100		ALDH7B4	aldehyde dehydrogenase 7B4 (.1...		Lus10013155 [exp]	7.7	0.9481

Compare expression of checked genes

Lus10002656 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.