Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G05600 128 / 6e-36 EMB3101 EMBRYO DEFECTIVE 3101, Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2) AT3G09060 60 / 1e-11 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G74580 56 / 3e-10 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT5G16420 44 / 4e-06 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) AT5G64320 43 / 1e-05 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT5G59900 42 / 2e-05 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT5G62370 41 / 6e-05 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G15200 40 / 9e-05 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT1G31430 40 / 9e-05 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) AT3G22670 39 / 0.0004 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10030200 [exp] 197 / 5e-61 AT1G05600 580 / 0.0 EMBRYO DEFECTIVE 3101, Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2) Lus10030222 [exp] 57 / 2e-10 AT5G16420 377 / 1e-128 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Lus10005989 [exp] 54 / 1e-09 AT5G16420 656 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Lus10002675 [exp] 45 / 2e-06 AT4G01400 570 / 0.0 unknown protein Lus10035981 [exp] 43 / 1e-05 AT2G17525 684 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10038804 [exp] 42 / 3e-05 AT5G64320 367 / 3e-115 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10009661 [exp] 40 / 0.0001 AT3G48810 440 / 3e-149 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10009023 [exp] 39 / 0.0003 AT3G48810 543 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10026747 [exp] 39 / 0.0003 AT1G06710 1190 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G179300 [exp] 145 / 2e-42 AT1G05600 649 / 0.0 EMBRYO DEFECTIVE 3101, Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2) Potri.011G108500 [exp] 55 / 9e-10 AT1G53330 483 / 1e-168 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.012G031600 [exp] 52 / 1e-08 AT5G16420 707 / 0.0 Pentatricopeptide repeat (PPR-like) superfamily protein (.1) Potri.010G234500 [exp] 52 / 1e-08 AT1G74580 1034 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.011G057900 [exp] 48 / 3e-07 AT5G46100 627 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.002G103600 [exp] 47 / 7e-07 AT5G18475 546 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.016G111600 [exp] 44 / 4e-06 AT3G09060 860 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.004G013300 [exp] 44 / 6e-06 AT3G53700 1092 / 0.0 maternal effect embryo arrest 40, Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.010G173400 [exp] 44 / 7e-06 AT1G79490 1295 / 0.0 embryo defective 2217, Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.008G098700 [exp] 43 / 1e-05 AT3G06430 692 / 0.0 pentatricopeptide repeat 2, embryo defective 2750, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0020 [flax] [poplar] TPR PF01535 [flax] [poplar] PPR PPR repeat
Representative CDS sequence Show only first row Show all	>Lus10002682 pacid=23159077 polypeptide=Lus10002682 locus=Lus10002682.g ID=Lus10002682.BGIv1.0 annot-version=v1.0 ATGAGTGTACGGTGGCCGAGGGTTCTAACCCCGACGTATCTTTCCCAAGTCATAAGGAATCAGAAAAACCCTCTGAAAGCACTGCAGCTCTTCGAGAATA CAAAAACTAGGTCTCCAAACTACCGCCAGAACGGCCCCGTTTACGCCGCCATGATCGATCTCCTAGGCAAATGCGGAAAATTCCACGAAATGAAACAAGT GATCGACAAAATGAGAGACGATTCATGCAAATGCAAAGACATAGTATTCGTCAATGCAATCAACACCTACGCTGCTGCAGGAATGATCGACGAAGCAAGG ACATCCCAAACTTCAACTGTGTCAACTGGAATGAATCTTTCAACACATTGCTAA
AA sequence Show only first row Show all	>Lus10002682 pacid=23159077 polypeptide=Lus10002682 locus=Lus10002682.g ID=Lus10002682.BGIv1.0 annot-version=v1.0 MSVRWPRVLTPTYLSQVIRNQKNPLKALQLFENTKTRSPNYRQNGPVYAAMIDLLGKCGKFHEMKQVIDKMRDDSCKCKDIVFVNAINTYAAAGMIDEAR TSQTSTVSTGMNLSTHC

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G05600		EMB3101	EMBRYO DEFECTIVE 3101, Tetratr...		Lus10002682 [exp]	0	1
AT5G48970			Mitochondrial substrate carrie...		Lus10037508 [exp]	8.1	0.7648
AT1G15220		ATCCMH	cytochrome c biogenesis protei...		Lus10027231 [exp]	10.7	0.7428
AT5G28770	bZIP	BZO2H3, ATBZIP6...	Arabidopsis thaliana basic leu...		Lus10015913 [exp]	16.1	0.7437
AT4G12560		CPR1, CPR30	CONSTITUTIVE EXPRESSER OF PR G...		Lus10043335 [exp]	16.5	0.7185
AT1G69630			F-box/RNI-like superfamily pro...		Lus10002239 [exp]	20.5	0.7386
AT2G45520			unknown protein		Lus10009304 [exp]	24.5	0.7290
AT5G28770	bZIP	BZO2H3, ATBZIP6...	Arabidopsis thaliana basic leu...		Lus10006590 [exp]	34.9	0.7148
AT1G07110		FKFBP, ATF2KP, ...	"fructose-2,6-bisphosphatase",...		Lus10026380 [exp]	35.8	0.7149
AT2G31290			Ubiquitin carboxyl-terminal hy...		Lus10003062 [exp]	37.3	0.7227
AT3G44900		ATCHX4	cation/H+ exchanger 4, cation/...		Lus10040963 [exp]	50.9	0.6889

Compare expression of checked genes

Lus10002682 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.