Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10003006 pacid=23176144 polypeptide=Lus10003006 locus=Lus10003006.g ID=Lus10003006.BGIv1.0 annot-version=v1.0 ATGGAGAGATCTTCTTCTAGCCTTCGTCACTCACTGTGGGAGTCTTCTCCGCCGTTTCTCTGGTTCGATTTCACTGTTCGGAAGAGAAATCGGATGAGCG AACTGTTCGCGCCGGCGATTCCTGATTTCCTTCACCAAGTCATCATTGTCATCTCAACGTTCTTGCTGTGCGCTCGGAAGTGGTTTGCGATTGACCGACG ATCTGAGCTTACTTCACCTGCTCCTTGCCATCGTCTCAAACATGTGTTGGTTAGTAGACTTCTCTAA
AA sequence Show only first row Show all	>Lus10003006 pacid=23176144 polypeptide=Lus10003006 locus=Lus10003006.g ID=Lus10003006.BGIv1.0 annot-version=v1.0 MERSSSSLRHSLWESSPPFLWFDFTVRKRNRMSELFAPAIPDFLHQVIIVISTFLLCARKWFAIDRRSELTSPAPCHRLKHVLVSRLL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10003006 [exp]	0	1
					Lus10019221 [exp]	12.9	0.8340
AT3G17440		ATNPSN13, NPSN1...	novel plant snare 13 (.1.2)		Lus10000163 [exp]	20.9	0.7346
AT3G14470			NB-ARC domain-containing disea...		Lus10002736 [exp]	24.1	0.8235
					Lus10027106 [exp]	25.4	0.7349
AT4G21670		FRY2, FLP1, ATC...	FIERY 2, C-terminal domain pho...		Lus10011195 [exp]	30.6	0.8151
AT1G58250		SAB	SABRE, Golgi-body localisation...		Lus10002603 [exp]	120.1	0.7773
AT3G58470			nucleic acid binding;methyltra...		Lus10016230 [exp]	120.5	0.7763
AT1G10130		ATECA3, ECA3	ARABIDOPSIS THALIANA ER-TYPE C...		Lus10018669 [exp]	141.7	0.7606
AT5G55260		EP128, PPX-2, P...	PROTEIN PHOSPHATASE X -2, prot...		Lus10013094 [exp]	172.3	0.7593
AT4G34310			alpha/beta-Hydrolases superfam...		Lus10042664 [exp]	173.8	0.7557

Compare expression of checked genes

Lus10003006 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.