Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G04260 89 / 9e-22 PDE324, PTAC3 PIGMENT DEFECTIVE 324, plastid transcriptionally active 3 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.019G025100 [exp] 86 / 7e-21 AT3G04260 1230 / 0.0 PIGMENT DEFECTIVE 324, plastid transcriptionally active 3 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10003577 pacid=23165467 polypeptide=Lus10003577 locus=Lus10003577.g ID=Lus10003577.BGIv1.0 annot-version=v1.0 ATGTTTCAGGTGATACAACTAGGAGGAAAACCAACGATAGGAGATTGTGCGATGATCCTGCGAGCAGCATTGACAGCTCCTGTGCCTCCAGCTTTGCTGC AGATCTTACAGATCACACACAAATTGGGCTACGTATTTGGAAGCCCTCTATACGAGGAAGTTATCGCCTTGTGCATTGAGCTGGGGGAAATAGATGCTGC AATTGCTATTGCTGCAGAGATGGCGACCTCTGGAATCAATGTCGCGGATGAAACCCTCGACAAGGTAATTGCTGCTAGACGGGAAGCTGATGATATTGAC AAGGAAGATACCGGCAAGAAAACTTGA
AA sequence Show only first row Show all	>Lus10003577 pacid=23165467 polypeptide=Lus10003577 locus=Lus10003577.g ID=Lus10003577.BGIv1.0 annot-version=v1.0 MFQVIQLGGKPTIGDCAMILRAALTAPVPPALLQILQITHKLGYVFGSPLYEEVIALCIELGEIDAAIAIAAEMATSGINVADETLDKVIAARREADDID KEDTGKKT

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G04260		PDE324, PTAC3	PIGMENT DEFECTIVE 324, plastid...		Lus10003577 [exp]	0	1
AT3G18680			Amino acid kinase family prote...		Lus10020884 [exp]	1.4	0.9649
AT2G35500		SKL2	shikimate kinase-like 2, shiki...		Lus10035389 [exp]	2.4	0.9420
AT5G40160		EMB139, EMB506	embryo defective 506, EMBRYO D...		Lus10032165 [exp]	2.8	0.9436
AT3G48500		PDE312, PTAC10	PLASTID TRANSCRIPTIONALLY ACTI...		Lus10005030 [exp]	3.0	0.9382
AT3G09210		PTAC13	plastid transcriptionally acti...		Lus10035543 [exp]	4.0	0.9490
AT5G39830		DEG8, DEGP8	DEG PROTEASE 8, Trypsin family...		Lus10007262 [exp]	7.5	0.9489
AT4G37170			Pentatricopeptide repeat (PPR)...		Lus10007772 [exp]	10.1	0.8924
AT3G13180			NOL1/NOP2/sun family protein /...		Lus10022523 [exp]	10.2	0.8919
AT3G55280		RPL23A2, RPL23A...	RIBOSOMAL PROTEIN L23A2, ribos...		Lus10025302 [exp]	10.2	0.9305
AT1G01080			RNA-binding (RRM/RBD/RNP motif...		Lus10030194 [exp]	10.6	0.9383

Compare expression of checked genes

Lus10003577 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.