Lus10003852 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10002087 107 / 4e-31 ND /
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10003852 pacid=23163340 polypeptide=Lus10003852 locus=Lus10003852.g ID=Lus10003852.BGIv1.0 annot-version=v1.0
ATGGGGGGTTGCGCCACCAAGCCAAAGGTCGCCAAAGACCAGAATCTCCCGGCGCCGGCGCCTGAGAAGGGGGATGAGCTAGCCACGTCCACCGCTGTGG
ATACGACGGAAGTGGAGGAGAAGGAGGTTGTGGTCGTCGGAGGTGAAGAAGGAGAGAAGAAGAAAGGTGACGGCGAGACCCTCAGTCAACAGCTGTTGAA
GGAGAGCACGGAAGAAGAAACAGAGACCATCGTAGAAAACGGTAACAAGTCATCGTTGCCGGAAGCGGCAGTGGAAGTGACGATGATGGAGGCCGGGAAA
GGTGATGCTCCGGAGGCGGCGGCGGCAGAAGTGGTGAAGGAGGCCGTTGCTGTAAGTTGA
AA sequence
>Lus10003852 pacid=23163340 polypeptide=Lus10003852 locus=Lus10003852.g ID=Lus10003852.BGIv1.0 annot-version=v1.0
MGGCATKPKVAKDQNLPAPAPEKGDELATSTAVDTTEVEEKEVVVVGGEEGEKKKGDGETLSQQLLKESTEEETETIVENGNKSSLPEAAVEVTMMEAGK
GDAPEAAAAEVVKEAVAVS

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10003852 0 1
Lus10002087 3.2 0.9330
AT5G47450 ATTIP2;3, DELTA... DELTA-TONOPLAST INTRINSIC PROT... Lus10007796 4.7 0.9214
AT2G41660 MIZ1 mizu-kussei 1, Protein of unkn... Lus10031059 6.9 0.9011
AT5G57685 LSB1, ATGDU3 LESS SUSCEPTIBLE TO BSCTV 1, A... Lus10008910 8.1 0.8531
AT3G63520 ATNCED1, ATCCD1... carotenoid cleavage dioxygenas... Lus10016410 8.2 0.8530
AT2G21100 Disease resistance-responsive ... Lus10034479 8.7 0.9185
AT5G05320 FAD/NAD(P)-binding oxidoreduct... Lus10025068 9.9 0.9194
AT4G36810 GGPS1 geranylgeranyl pyrophosphate s... Lus10009138 10.6 0.8931
AT2G39710 Eukaryotic aspartyl protease f... Lus10040279 10.6 0.8940
AT5G45890 SAG12 senescence-associated gene 12 ... Lus10006542 13.0 0.8569

Lus10003852 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.