Lus10003884 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G33355 72 / 7e-17 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2)
AT2G15050 60 / 3e-12 LTP7, LTP lipid transfer protein 7, lipid transfer protein (.1.2.3)
AT2G38530 57 / 3e-11 cdf3, LP2, LTP2 cell growth defect factor-3, lipid transfer protein 2 (.1)
AT2G18370 57 / 4e-11 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1)
AT5G59320 55 / 2e-10 LTP3 lipid transfer protein 3 (.1)
AT5G59310 52 / 2e-09 LTP4 lipid transfer protein 4 (.1)
AT3G51590 49 / 3e-08 LTP12 lipid transfer protein 12 (.1)
AT3G51600 47 / 1e-07 LTP5 lipid transfer protein 5 (.1)
AT5G01870 47 / 1e-07 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1)
AT2G38540 46 / 5e-07 ATLTP1, LP1 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10001829 214 / 1e-72 AT4G33355 81 / 1e-20 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2)
Lus10023087 129 / 4e-39 AT4G33355 69 / 8e-16 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2)
Lus10032381 135 / 1e-38 AT5G62050 270 / 4e-87 HOMOLOG OF YEAST OXIDASE ASSEMBLY 1 \(OXA1\) IN ARABIDOPSIS THALIANA, ARABIDOPSIS THALIANA HOMOLOG OF YEAST OXIDASE ASSEMBLY 1 \(OXA1\), homolog of yeast oxidase assembly 1 (OXA1) (.1)
Lus10022745 67 / 7e-15 AT5G59310 103 / 1e-29 lipid transfer protein 4 (.1)
Lus10014167 66 / 1e-14 AT5G59310 102 / 2e-29 lipid transfer protein 4 (.1)
Lus10015279 66 / 2e-14 AT5G59320 116 / 6e-35 lipid transfer protein 3 (.1)
Lus10001703 63 / 1e-13 AT4G33355 86 / 9e-23 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2)
Lus10007280 62 / 3e-13 AT5G59310 90 / 2e-24 lipid transfer protein 4 (.1)
Lus10012384 61 / 7e-13 AT5G59310 76 / 4e-19 lipid transfer protein 4 (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.014G046500 72 / 8e-17 AT4G33355 76 / 6e-19 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1.2)
Potri.014G098000 64 / 6e-14 AT5G59310 71 / 9e-17 lipid transfer protein 4 (.1)
Potri.004G086600 61 / 1e-12 AT2G38540 122 / 3e-37 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1)
Potri.001G232900 60 / 3e-12 AT2G18370 100 / 3e-28 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1)
Potri.001G232700 59 / 5e-12 AT2G18370 93 / 1e-25 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (.1)
Potri.011G022150 58 / 2e-11 AT3G51590 54 / 2e-10 lipid transfer protein 12 (.1)
Potri.011G021900 57 / 2e-11 AT3G08770 60 / 8e-13 lipid transfer protein 6 (.1.2)
Potri.004G086500 57 / 2e-11 AT2G38540 124 / 5e-38 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1)
Potri.006G108100 52 / 3e-09 AT2G38540 121 / 6e-37 ARABIDOPSIS THALIANA LIPID TRANSFER PROTEIN 1, lipid transfer protein 1 (.1)
Potri.016G135700 51 / 5e-09 AT5G59310 92 / 3e-25 lipid transfer protein 4 (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0482 Prolamin PF00234 Tryp_alpha_amyl Protease inhibitor/seed storage/LTP family
Representative CDS sequence
>Lus10003884 pacid=23144342 polypeptide=Lus10003884 locus=Lus10003884.g ID=Lus10003884.BGIv1.0 annot-version=v1.0
ATGGCGAGTCCGAGTCGTTACTTGACAATAGTCGTGATGGCAATTTTCTTGGTCAGTGGGCAGGTAGTGACGACGGGAGCTAGCTATAGAAGACAGCTGC
TGCAGGCAGCGTCGCCGTCTTGCCCCGCAATCTATTCCGACTTGAGGCCGTGCACTCCTTACTTAACGGGAATGAACGGAGATCCGTCAAGACAATGCTG
CAGCGGGGTGAGCGAACTTCAGCCTTACTCCACGCGGAAGTCGGACAGGGTAGAGATTTGTCAGTGCCTCAAGTCCTTGGCCCTCCTCGTTCCAGGCCTT
GACTTGTCCGTCGCATCTACGCTCCCCAAGAAGTGTAAAGCCAACGTCAAGCTCCCCAAGCTTTCTCTCAACATCGACTGTTCCAAGTGCGTTTCCATTT
TACTGAGAGTTATTTATGTATGTAACTTGCGTGTTTGA
AA sequence
>Lus10003884 pacid=23144342 polypeptide=Lus10003884 locus=Lus10003884.g ID=Lus10003884.BGIv1.0 annot-version=v1.0
MASPSRYLTIVVMAIFLVSGQVVTTGASYRRQLLQAASPSCPAIYSDLRPCTPYLTGMNGDPSRQCCSGVSELQPYSTRKSDRVEICQCLKSLALLVPGL
DLSVASTLPKKCKANVKLPKLSLNIDCSKCVSILLRVIYVCNLRV

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT4G33355 Bifunctional inhibitor/lipid-t... Lus10003884 0 1

Lus10003884 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.