Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G17220 79 / 2e-18 ATMAP70-5 microtubule-associated proteins 70-5 (.1) AT1G24764 66 / 9e-14 ATMAP70-2 microtubule-associated proteins 70-2 (.1) AT1G68060 65 / 1e-13 ATMAP70-1 microtubule-associated proteins 70-1 (.1) AT1G14840 64 / 3e-13 ATMAP70-4 microtubule-associated proteins 70-4 (.1.2) AT2G01750 63 / 8e-13 ATMAP70-3 microtubule-associated proteins 70-3 (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10038790 [exp] 94 / 1e-23 AT4G17220 473 / 5e-163 microtubule-associated proteins 70-5 (.1) Lus10030758 [exp] 65 / 2e-13 AT1G24764 918 / 0.0 microtubule-associated proteins 70-2 (.1) Lus10013238 [exp] 65 / 2e-13 AT1G24764 910 / 0.0 microtubule-associated proteins 70-2 (.1) Lus10019171 [exp] 45 / 1e-06 AT1G24764 546 / 0.0 microtubule-associated proteins 70-2 (.1) Lus10000642 [exp] 40 / 8e-05 AT1G24764 403 / 1e-136 microtubule-associated proteins 70-2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G018000 [exp] 89 / 4e-22 AT4G17220 464 / 5e-159 microtubule-associated proteins 70-5 (.1) Potri.016G006900 [exp] 83 / 7e-20 AT4G17220 453 / 1e-154 microtubule-associated proteins 70-5 (.1) Potri.016G036300 [exp] 74 / 1e-16 AT1G68060 619 / 0.0 microtubule-associated proteins 70-1 (.1) Potri.006G039200 [exp] 67 / 2e-14 AT1G24764 648 / 0.0 microtubule-associated proteins 70-2 (.1) Potri.010G106100 [exp] 66 / 5e-14 AT1G68060 751 / 0.0 microtubule-associated proteins 70-1 (.1) Potri.008G135100 [exp] 61 / 3e-12 AT1G24764 804 / 0.0 microtubule-associated proteins 70-2 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF07058 [flax] [poplar] MAP70 Microtubule-associated protein 70
Representative CDS sequence Show only first row Show all	>Lus10003908 pacid=23144334 polypeptide=Lus10003908 locus=Lus10003908.g ID=Lus10003908.BGIv1.0 annot-version=v1.0 ATGTCAAAAAGAAGCCTGAAACCTGAAGTTGAAGATTTTGTTTCAGGGCTTTTGTATGATCAACTTCAGAAGGAAGTCATAAATTTAAGGAAAGCATGTG AGGCGAAAGATAATTGCTTGAATGCTAAAGATCAGAAAATCCAGATGTTGATGAGGAAGGTCGATTCCTTAACAAAATCCATTGAGGTAGAGTCCAAGAA ACTGAAGAGAGAAGCAGCAGCAGCAGCAAGGGAAAAGGAAACTGGATCAGCAAAGTTGGATCAAAGTAGAAAGACTGCTGCATGTACAAACCAATATTGA
AA sequence Show only first row Show all	>Lus10003908 pacid=23144334 polypeptide=Lus10003908 locus=Lus10003908.g ID=Lus10003908.BGIv1.0 annot-version=v1.0 MSKRSLKPEVEDFVSGLLYDQLQKEVINLRKACEAKDNCLNAKDQKIQMLMRKVDSLTKSIEVESKKLKREAAAAAREKETGSAKLDQSRKTAACTNQY

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G17220		ATMAP70-5	microtubule-associated protein...		Lus10003908 [exp]	0	1
AT5G22450			unknown protein		Lus10000530 [exp]	1.4	1.0000
					Lus10003536 [exp]	2.0	1.0000
					Lus10011078 [exp]	3.0	1.0000
					Lus10011425 [exp]	3.5	1.0000
					Lus10023589 [exp]	3.5	1.0000
AT2G20420			ATP citrate lyase (ACL) family...		Lus10022902 [exp]	3.9	1.0000
					Lus10012998 [exp]	4.2	1.0000
AT1G08510		FATB	fatty acyl-ACP thioesterases B...		Lus10025763 [exp]	4.6	1.0000
					Lus10028667 [exp]	4.7	1.0000
					Lus10027689 [exp]	4.9	1.0000

Compare expression of checked genes

Lus10003908 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.