Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G37670 138 / 2e-43 HSP15.7CI HSP20-like chaperones superfamily protein (.1) AT1G59860 96 / 3e-26 HSP20-like chaperones superfamily protein (.1) AT1G53540 94 / 1e-25 HSP20-like chaperones superfamily protein (.1) AT1G07400 94 / 2e-25 HSP20-like chaperones superfamily protein (.1) AT3G46230 81 / 3e-20 ATHSP17.4 ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.4, heat shock protein 17.4 (.1) AT2G29500 79 / 7e-20 HSP20-like chaperones superfamily protein (.1) AT5G59720 79 / 1e-19 HSP18.2 HSP18.1CI heat shock protein 18.2 (.1) AT4G10250 67 / 6e-15 ATHSP22.0 HSP20-like chaperones superfamily protein (.1) AT5G12020 56 / 1e-10 HSP17.6II 17.6 kDa class II heat shock protein (.1) AT4G21870 53 / 6e-10 HSP20-like chaperones superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10020815 [exp] 188 / 8e-63 AT5G37670 166 / 6e-54 HSP20-like chaperones superfamily protein (.1) Lus10009085 [exp] 83 / 5e-21 AT1G53540 232 / 2e-79 HSP20-like chaperones superfamily protein (.1) Lus10042408 [exp] 80 / 1e-19 AT4G10250 154 / 1e-47 HSP20-like chaperones superfamily protein (.1) Lus10026262 [exp] 78 / 5e-19 AT4G10250 152 / 5e-47 HSP20-like chaperones superfamily protein (.1) Lus10040723 [exp] 77 / 5e-19 AT2G29500 219 / 3e-74 HSP20-like chaperones superfamily protein (.1) Lus10040722 [exp] 77 / 7e-19 AT1G07400 214 / 2e-72 HSP20-like chaperones superfamily protein (.1) Lus10000932 [exp] 78 / 1e-18 AT4G10250 200 / 2e-65 HSP20-like chaperones superfamily protein (.1) Lus10016457 [exp] 76 / 3e-18 AT1G07400 216 / 4e-73 HSP20-like chaperones superfamily protein (.1) Lus10016456 [exp] 75 / 4e-18 AT1G07400 213 / 8e-72 HSP20-like chaperones superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G130700 [exp] 150 / 4e-48 AT5G37670 160 / 1e-51 HSP20-like chaperones superfamily protein (.1) Potri.009G039200 [exp] 102 / 7e-29 AT1G07400 201 / 3e-67 HSP20-like chaperones superfamily protein (.1) Potri.010G175200 [exp] 99 / 1e-27 AT1G53540 107 / 5e-30 HSP20-like chaperones superfamily protein (.1) Potri.009G148000 [exp] 97 / 6e-27 AT2G29500 190 / 7e-63 HSP20-like chaperones superfamily protein (.1) Potri.019G081250 [exp] 95 / 7e-26 AT2G29500 182 / 6e-60 HSP20-like chaperones superfamily protein (.1) Potri.004G187450 [exp] 94 / 2e-25 AT2G29500 221 / 5e-75 HSP20-like chaperones superfamily protein (.1) Potri.009G147900 [exp] 92 / 1e-24 AT2G29500 193 / 5e-64 HSP20-like chaperones superfamily protein (.1) Potri.009G049900 [exp] 91 / 1e-24 AT2G29500 154 / 2e-48 HSP20-like chaperones superfamily protein (.1) Potri.004G187400 [exp] 91 / 2e-24 AT1G07400 193 / 7e-64 HSP20-like chaperones superfamily protein (.1) Potri.009G049800 [exp] 91 / 3e-24 AT2G29500 152 / 4e-48 HSP20-like chaperones superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0190 [flax] [poplar] HSP20 PF00011 [flax] [poplar] HSP20 Hsp20/alpha crystallin family
Representative CDS sequence Show only first row Show all	>Lus10004039 pacid=23156729 polypeptide=Lus10004039 locus=Lus10004039.g ID=Lus10004039.BGIv1.0 annot-version=v1.0 ATGGACTGGCTGGAGTCACCAACTGCCCACATCTTCAAGATCAACGTCCCAGGGTTTAGCAAGGAGGACATAAAAGTACAATTGGAAGCAGGGAACGTGC TACACATCAGTGGAGGAGGAGGAGGCGACGAGAAGAGGGACGAGAAGAAGGACGCCGTGTGGCACCTGGCGGAGAGAGGGGCGACGAAGGGCGGAGGATT CTCTAGGGAGGTAGAGCTGCCGGAGAATGTGAAGGTCGATCAGATTAAGGCTCAGGTTGAGAACGGAGTTCTGACTATCATTGTTCCCAAGGATAATTCG GCTAAGCAACCTAAAGTGAGGAACATCGCCATTTCCAGCAAGCTTTGA
AA sequence Show only first row Show all	>Lus10004039 pacid=23156729 polypeptide=Lus10004039 locus=Lus10004039.g ID=Lus10004039.BGIv1.0 annot-version=v1.0 MDWLESPTAHIFKINVPGFSKEDIKVQLEAGNVLHISGGGGGDEKRDEKKDAVWHLAERGATKGGGFSREVELPENVKVDQIKAQVENGVLTIIVPKDNS AKQPKVRNIAISSKL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G37670		HSP15.7CI	HSP20-like chaperones superfam...		Lus10004039 [exp]	0	1
AT2G26150	HSF	ATHSFA2	heat shock transcription facto...		Lus10039134 [exp]	1.0	0.9479
AT4G10250		ATHSP22.0	HSP20-like chaperones superfam...		Lus10000932 [exp]	2.8	0.8911
AT1G16030		HSP70B	heat shock protein 70B (.1)		Lus10041615 [exp]	3.0	0.8974
AT5G35320			unknown protein		Lus10027608 [exp]	3.2	0.8868
AT3G10020			unknown protein		Lus10002842 [exp]	3.5	0.8976
AT3G52525	OFP	ATOFP6, OFP6	ARABIDOPSIS THALIANA OVATE FAM...		Lus10007159 [exp]	7.2	0.7580
AT4G27670		HSP21	heat shock protein 21 (.1)		Lus10011385 [exp]	7.4	0.8238
AT5G65100	EIL		Ethylene insensitive 3 family ...		Lus10041709 [exp]	9.2	0.6879
AT4G27670		HSP21	heat shock protein 21 (.1)		Lus10014876 [exp]	13.4	0.8746
AT5G07330			unknown protein		Lus10042036 [exp]	13.8	0.8409

Compare expression of checked genes

Lus10004039 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.