Lus10004051 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10011397 72 / 6e-16 AT4G00930 83 / 8e-16 COP1-interacting protein 4.1 (.1)
Lus10006453 53 / 4e-09 AT5G37190 85 / 3e-16 COP1-interacting protein 4 (.1)
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10004051 pacid=23156706 polypeptide=Lus10004051 locus=Lus10004051.g ID=Lus10004051.BGIv1.0 annot-version=v1.0
ATGGATAAAGAAGTCAATGATATTGATGAGCGATCTGTGAACGAAGCTGGAGATGGAAATTTGGTTTCAGAACCTAATAATATTACTGATATTAATGGCT
TTCAAAATCCAGTACTTGATGAGATGCATAGAGTTGCAACAGAAAAACCAGCGGTGTCCCAGACTATCTCTACAGAAGTGCAGAAAGAAGTTCATTTTGA
ATTGCCTGAGGCTGCTCCATCTATGAATAGTTTTGCATTGAAGAAACCGAAGAAATCAAGAAAGTATCTATCTATATTGAGTTTGGAGCTTGGTTTGGAC
CAGGCCAGTGAGTCTTGGGAACGGAATCAACCACATTCTTGA
AA sequence
>Lus10004051 pacid=23156706 polypeptide=Lus10004051 locus=Lus10004051.g ID=Lus10004051.BGIv1.0 annot-version=v1.0
MDKEVNDIDERSVNEAGDGNLVSEPNNITDINGFQNPVLDEMHRVATEKPAVSQTISTEVQKEVHFELPEAAPSMNSFALKKPKKSRKYLSILSLELGLD
QASESWERNQPHS

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10004051 0 1
AT4G02610 Aldolase-type TIM barrel famil... Lus10024848 27.5 0.5935
AT4G39330 AtCAD1, ATCAD9 cinnamyl alcohol dehydrogenase... Lus10003854 52.4 0.6817
AT5G27260 unknown protein Lus10035759 140.5 0.6147
Lus10019266 148.8 0.5985
AT1G19835 Plant protein of unknown funct... Lus10034510 252.5 0.5864
AT4G04640 ATPC1 ATPase, F1 complex, gamma subu... Lus10021535 253.8 0.5923

Lus10004051 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.