Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G01830 193 / 3e-58 ABCB5, PGP5 ATP-binding cassette B5, P-glycoprotein 5 (.1) AT1G02520 189 / 8e-57 MDR8, ABCB11, PGP11 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1) AT1G02530 184 / 3e-55 ABCB12, PGP12 ATP-binding cassette B12, P-glycoprotein 12 (.1) AT2G47000 184 / 6e-55 PGP4 ,MDR4, ABCB4, ATPGP4 MULTIDRUG RESISTANCE 4, ARABIDOPSIS P-GLYCOPROTEIN 4, ATP-binding cassette B4, ATP binding cassette subfamily B4 (.1) AT3G62150 183 / 9e-55 ABCB21, PGP21 ATP-binding cassette B21, P-glycoprotein 21 (.1) AT5G46540 172 / 1e-50 ABCB7, PGP7 ATP-binding cassette B7, P-glycoprotein 7 (.1) AT4G18050 167 / 6e-49 ABCB9, PGP9 ATP-binding cassette B9, P-glycoprotein 9 (.1) AT4G01820 166 / 8e-49 ABCB3, MDR3, PGP3 ATP-binding cassette B3, P-glycoprotein 3 (.1) AT1G10680 153 / 4e-44 ABCB10, PGP10 ATP-binding cassette B10, P-glycoprotein 10 (.1) AT3G28360 150 / 3e-43 ABCB16, PGP16 ATP-binding cassette B16, P-glycoprotein 16 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10000052 [exp] 218 / 5e-74 AT3G62150 284 / 2e-89 ATP-binding cassette B21, P-glycoprotein 21 (.1) Lus10010067 [exp] 217 / 1e-66 AT1G02520 1748 / 0.0 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1) Lus10038049 [exp] 197 / 2e-59 AT3G62150 1891 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Lus10004519 [exp] 189 / 2e-59 AT1G02520 636 / 0.0 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1) Lus10009988 [exp] 195 / 6e-59 AT3G62150 1896 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Lus10010012 [exp] 191 / 1e-57 AT1G02520 1526 / 0.0 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1) Lus10009989 [exp] 191 / 3e-57 AT2G47000 1754 / 0.0 MULTIDRUG RESISTANCE 4, ARABIDOPSIS P-GLYCOPROTEIN 4, ATP-binding cassette B4, ATP binding cassette subfamily B4 (.1) Lus10038050 [exp] 190 / 5e-57 AT2G47000 1697 / 0.0 MULTIDRUG RESISTANCE 4, ARABIDOPSIS P-GLYCOPROTEIN 4, ATP-binding cassette B4, ATP binding cassette subfamily B4 (.1) Lus10010068 [exp] 189 / 1e-56 AT3G62150 1820 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G187500 [exp] 194 / 1e-58 AT3G62150 1860 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Potri.014G113200 [exp] 194 / 2e-58 AT3G62150 1871 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Potri.014G113500 [exp] 194 / 2e-58 AT3G62150 1879 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Potri.010G003000 [exp] 190 / 3e-57 AT2G47000 1585 / 0.0 MULTIDRUG RESISTANCE 4, ARABIDOPSIS P-GLYCOPROTEIN 4, ATP-binding cassette B4, ATP binding cassette subfamily B4 (.1) Potri.002G187400 [exp] 185 / 2e-55 AT3G62150 1702 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Potri.014G113000 [exp] 185 / 2e-55 AT3G62150 1767 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Potri.014G113100 [exp] 180 / 1e-53 AT1G02520 1773 / 0.0 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1) Potri.001G354900 [exp] 160 / 1e-46 AT4G18050 1723 / 0.0 ATP-binding cassette B9, P-glycoprotein 9 (.1) Potri.003G094400 [exp] 156 / 3e-45 AT4G25960 2000 / 0.0 ATP-binding cassette B2, P-glycoprotein 2 (.1) Potri.001G139600 [exp] 154 / 9e-45 AT4G25960 1962 / 0.0 ATP-binding cassette B2, P-glycoprotein 2 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0023 [flax] [poplar] P-loop_NTPase PF00005 [flax] [poplar] ABC_tran ABC transporter
Representative CDS sequence Show only first row Show all	>Lus10004518 pacid=23182197 polypeptide=Lus10004518 locus=Lus10004518.g ID=Lus10004518.BGIv1.0 annot-version=v1.0 ATGGGTCTGGTGGGGCAAGAACCTTCATTGTTCAACGACACAATCAGAGCAAACATTGTATACGGGAAAGAAGGGAATGCAAGTGAGGCAGAGATCATAG CTGCATCAAAGCTTGCCAACGCACACAGATTCATCAACGGATTACAACACGGCTATGATACGATTGTTGGAGAACGTGGAATCCAGTTGTCAGGAGGGCA GAAGCAAAGGGTAGCCATTGCTCGAGCTATCGTGAAAGAACCAAAGATATTGCTGTTGGGCGAGGCGACCAGTGCGCTTGATGCCGAGTCTGAAAGAGTG GTACAGGATGCATTGGATCAAGTGATGGTGAACAATGATCGTGGTAGCTCACCGACTATCGACTGTTAA
AA sequence Show only first row Show all	>Lus10004518 pacid=23182197 polypeptide=Lus10004518 locus=Lus10004518.g ID=Lus10004518.BGIv1.0 annot-version=v1.0 MGLVGQEPSLFNDTIRANIVYGKEGNASEAEIIAASKLANAHRFINGLQHGYDTIVGERGIQLSGGQKQRVAIARAIVKEPKILLLGEATSALDAESERV VQDALDQVMVNNDRGSSPTIDC

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G01830		ABCB5, PGP5	ATP-binding cassette B5, P-gly...		Lus10004518 [exp]	0	1
AT1G62930		RPF3	RNA processing factor 3, Tetra...		Lus10003446 [exp]	2.6	0.6795
AT3G49170		EMB2261	embryo defective 2261, Tetratr...		Lus10042161 [exp]	2.6	0.7580
AT4G08210			Pentatricopeptide repeat (PPR-...		Lus10028082 [exp]	10.5	0.7206
AT2G30800		ATVT-1, HVT1	helicase in vascular tissue an...		Lus10001049 [exp]	14.9	0.6636
AT5G13750		ZIFL1	zinc induced facilitator-like ...		Lus10035766 [exp]	16.5	0.6609
AT5G46460			Pentatricopeptide repeat (PPR)...		Lus10015256 [exp]	21.6	0.6721
AT3G49740			Tetratricopeptide repeat (TPR)...		Lus10011562 [exp]	23.6	0.6322
AT2G13600			Pentatricopeptide repeat (PPR)...		Lus10016390 [exp]	37.5	0.7003
AT3G05340			Tetratricopeptide repeat (TPR)...		Lus10015182 [exp]	37.6	0.5982
AT1G51560			Pyridoxamine 5'-phosphate oxid...		Lus10033378 [exp]	41.8	0.6892

Compare expression of checked genes

Lus10004518 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.