Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G09270 98 / 7e-28 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10020609 [exp] 171 / 1e-56 AT5G09270 108 / 7e-32 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G066900 [exp] 116 / 3e-35 AT5G09270 120 / 1e-36 unknown protein Potri.007G102600 [exp] 106 / 5e-31 AT5G09270 107 / 1e-31 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10004877 pacid=23157156 polypeptide=Lus10004877 locus=Lus10004877.g ID=Lus10004877.BGIv1.0 annot-version=v1.0 ATGGCAACAGAAGAGAAAGGAGATGGCGAGCAGCAGACCGGAAGTCCCGCAGCCATCAATTTTGGCGGAAGAGTGGTGGACCAGTACCGAAAGCTCAAAG AACATGCAGAAGCTTACCCTTACGTGTGGGGTTCGTACATTGTCGTGTACGGTGGTTTCGGCTTCTATTTAGCCTACCGAGTGAGGAAACTCCGCCAAAC TGAGGACAGAGTTCGAGCCCTGCAGGAGAGACTTCGCAAACTCGCTAAGGAGCCAGTTGCATCTTCTTCTTCCACGGCATCAACTTCTTCTGCAACAGCA CCATCATCGTCGACTAATACACCGTCCAAGTAG
AA sequence Show only first row Show all	>Lus10004877 pacid=23157156 polypeptide=Lus10004877 locus=Lus10004877.g ID=Lus10004877.BGIv1.0 annot-version=v1.0 MATEEKGDGEQQTGSPAAINFGGRVVDQYRKLKEHAEAYPYVWGSYIVVYGGFGFYLAYRVRKLRQTEDRVRALQERLRKLAKEPVASSSSTASTSSATA PSSSTNTPSK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G09270			unknown protein		Lus10004877 [exp]	0	1
AT5G38890			Nucleic acid-binding, OB-fold-...		Lus10004763 [exp]	3.0	0.8365
AT3G59650			mitochondrial ribosomal protei...		Lus10006114 [exp]	5.2	0.8331
AT2G47580		U1A	spliceosomal protein U1A (.1)		Lus10003358 [exp]	6.8	0.8358
AT1G07950		MED22B	Surfeit locus protein 5 subuni...		Lus10023466 [exp]	8.0	0.8325
AT2G18400			ribosomal protein L6 family pr...		Lus10026015 [exp]	10.1	0.8235
AT4G30220		RUXF	small nuclear ribonucleoprotei...		Lus10006867 [exp]	11.8	0.8201
AT3G23390			Zinc-binding ribosomal protein...		Lus10013436 [exp]	13.8	0.8281
AT4G02610			Aldolase-type TIM barrel famil...		Lus10024849 [exp]	14.1	0.7695
AT1G08580			unknown protein		Lus10040441 [exp]	14.8	0.8110
AT1G11240			unknown protein		Lus10018438 [exp]	17.9	0.8026

Compare expression of checked genes

Lus10004877 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.