Lus10005104 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT2G42350 77 / 9e-19 RING/U-box superfamily protein (.1)
AT2G42360 75 / 1e-17 RING/U-box superfamily protein (.1)
AT5G58580 60 / 6e-12 ATL63 TOXICOS EN LEVADURA 63 (.1)
AT4G10150 57 / 3e-11 RING/U-box superfamily protein (.1)
AT4G10160 57 / 6e-11 RING/U-box superfamily protein (.1)
AT5G05810 56 / 1e-10 ATL43 RING/U-box superfamily protein (.1)
AT2G35910 56 / 2e-10 RING/U-box superfamily protein (.1)
AT5G06490 55 / 2e-10 RING/U-box superfamily protein (.1)
AT2G18650 55 / 4e-10 MEE16 maternal effect embryo arrest 16, RING/U-box superfamily protein (.1)
AT2G25409 53 / 5e-10 unknown protein
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10002194 157 / 6e-50 AT2G42360 153 / 4e-46 RING/U-box superfamily protein (.1)
Lus10025338 58 / 1e-11 AT4G17905 99 / 4e-25 RING/U-box superfamily protein (.1)
Lus10029949 58 / 3e-11 AT3G05200 171 / 1e-50 RING/U-box superfamily protein (.1)
Lus10006787 57 / 5e-11 AT1G49230 159 / 9e-49 RING/U-box superfamily protein (.1)
Lus10015167 57 / 5e-11 AT3G05200 226 / 2e-71 RING/U-box superfamily protein (.1)
Lus10005954 57 / 6e-11 AT3G04020 111 / 7e-28 unknown protein
Lus10009264 56 / 6e-11 AT3G03550 77 / 4e-17 RING/U-box superfamily protein (.1)
Lus10024405 56 / 8e-11 AT4G17905 95 / 9e-24 RING/U-box superfamily protein (.1)
Lus10029456 54 / 9e-11 AT5G10380 86 / 3e-21 RING/U-box superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.019G091400 90 / 2e-23 AT2G42360 143 / 9e-42 RING/U-box superfamily protein (.1)
Potri.011G063100 66 / 2e-14 AT2G42350 106 / 3e-28 RING/U-box superfamily protein (.1)
Potri.006G144200 57 / 2e-11 AT5G17600 90 / 3e-21 RING/U-box superfamily protein (.1)
Potri.010G206200 57 / 2e-11 AT5G17600 91 / 6e-22 RING/U-box superfamily protein (.1)
Potri.008G019000 57 / 4e-11 AT5G06490 131 / 8e-39 RING/U-box superfamily protein (.1)
Potri.013G025800 57 / 9e-11 AT3G05200 261 / 9e-84 RING/U-box superfamily protein (.1)
Potri.015G056800 57 / 1e-10 AT5G05810 263 / 8e-85 RING/U-box superfamily protein (.1)
Potri.001G309600 56 / 1e-10 AT1G49230 261 / 6e-89 RING/U-box superfamily protein (.1)
Potri.009G073900 56 / 2e-10 AT5G58580 102 / 9e-26 TOXICOS EN LEVADURA 63 (.1)
Potri.010G010500 56 / 2e-10 AT3G16720 202 / 1e-63 TOXICOS EN LEVADURA 2 (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0229 RING PF00097 zf-C3HC4 Zinc finger, C3HC4 type (RING finger)
Representative CDS sequence
>Lus10005104 pacid=23171460 polypeptide=Lus10005104 locus=Lus10005104.g ID=Lus10005104.BGIv1.0 annot-version=v1.0
ATGGTAAGGAGTCTACCCAATTGTGGTCATGGATTTCACGCCGAGTGTGTAGACAAGTGGCTTAGCTGTCACACCACGTGTCCAATTTGTCGGACTGACG
CTGAGCCGCCAGTTACAATTAATATTGAGCCGGAACCCCGGGAGGGTCCCGCTGTGGCGGCGGATGCGAAAGTGGTGCCCACTGAAGCGGCAGCGTCGAG
CTCCAGAATGGGTTCGTTTAAAAGAATGCTGAGCAGGGAGCGATCGTCCAGGAGAATGCAGATTCAGATTCGAGAAGATGTCGAGAGACAGTGA
AA sequence
>Lus10005104 pacid=23171460 polypeptide=Lus10005104 locus=Lus10005104.g ID=Lus10005104.BGIv1.0 annot-version=v1.0
MVRSLPNCGHGFHAECVDKWLSCHTTCPICRTDAEPPVTINIEPEPREGPAVAADAKVVPTEAAASSSRMGSFKRMLSRERSSRRMQIQIREDVERQ

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT2G42350 RING/U-box superfamily protein... Lus10005104 0 1
AT2G38870 Serine protease inhibitor, pot... Lus10018783 1.0 0.9877
AT5G17740 P-loop containing nucleoside t... Lus10003213 1.4 0.9828
AT2G47140 AtSDR5 short-chain dehydrogenase redu... Lus10016178 3.7 0.9752
AT1G79460 ATKS1, ATKS, GA... GA REQUIRING 2, ARABIDOPSIS TH... Lus10034229 4.5 0.9811
AT3G11840 PUB24 plant U-box 24 (.1) Lus10004191 5.7 0.9813
AT3G52970 CYP76G1 "cytochrome P450, family 76, s... Lus10002839 9.4 0.9712
AT1G08080 ATACA7, ACA7 A. THALIANA ALPHA CARBONIC ANH... Lus10021455 12.0 0.9791
AT4G35580 NAC NTL9, CBNAC NAC transcription factor-like ... Lus10006119 13.9 0.9398
AT4G22030 F-box family protein with a do... Lus10020029 15.2 0.9675
AT2G38870 Serine protease inhibitor, pot... Lus10018786 16.8 0.9766

Lus10005104 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.