Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G36660 42 / 2e-05 PAB7 poly(A) binding protein 7 (.1) AT1G49760 39 / 0.0002 PABP8, PAB8 poly(A) binding protein 8 (.1), poly(A) binding protein 8 (.2) AT3G16380 38 / 0.0005 PAB6 poly(A) binding protein 6 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10021396 [exp] 134 / 5e-38 AT1G49760 351 / 6e-114 poly(A) binding protein 8 (.1), poly(A) binding protein 8 (.2) Lus10035556 [exp] 39 / 0.0003 AT2G36670 623 / 0.0 Eukaryotic aspartyl protease family protein (.1.2) Lus10027733 [exp] 39 / 0.0004 AT2G36660 569 / 0.0 poly(A) binding protein 7 (.1) Lus10002835 [exp] 38 / 0.0008 AT4G34110 918 / 0.0 ARABIDOPSIS POLY\(A\) BINDING 2, poly(A) binding protein 2 (.1) Lus10027886 [exp] 38 / 0.0008 AT4G34110 922 / 0.0 ARABIDOPSIS POLY\(A\) BINDING 2, poly(A) binding protein 2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G062700 [exp] 40 / 8e-05 AT1G22760 638 / 0.0 poly(A) binding protein 3 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0221 [flax] [poplar] RRM PF00076 [flax] [poplar] RRM_1 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
Representative CDS sequence Show only first row Show all	>Lus10005357 pacid=23148505 polypeptide=Lus10005357 locus=Lus10005357.g ID=Lus10005357.BGIv1.0 annot-version=v1.0 ATGGCGGCGGAGGTGGAGAATGCTCCGTCACCTTTGCTGTACGCGCTGTACGTCGGCGATGTTGACTCCATGGTCGTCGAGTCGCAGATAGTTGAGATAT ATTCCCGATTCCCCGGCTTCATGTCGGCTTCCCTTTGCCGGAATGATTCTCCTCTTACCGGAAACCCTCGTCACTATGCTTACGTCAATTTCCTCACTCT CCCTCAAGGTAATGAAGAAAAAGAAATAAAACAGAATTTATCTTTCGAAAGCTCGGTCAATGCTCGTAAGCTTGAATTTTCTATGTGTGCTCGACGGCTT TGTTACAATGTTGGTTTGAGGTTTAGGGTTTAG
AA sequence Show only first row Show all	>Lus10005357 pacid=23148505 polypeptide=Lus10005357 locus=Lus10005357.g ID=Lus10005357.BGIv1.0 annot-version=v1.0 MAAEVENAPSPLLYALYVGDVDSMVVESQIVEIYSRFPGFMSASLCRNDSPLTGNPRHYAYVNFLTLPQGNEEKEIKQNLSFESSVNARKLEFSMCARRL CYNVGLRFRV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G36660		PAB7	poly(A) binding protein 7 (.1)		Lus10005357 [exp]	0	1

Compare expression of checked genes

Lus10005357 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.