Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G195000 [exp] 37 / 8e-05 ND /
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10005379 pacid=23155605 polypeptide=Lus10005379 locus=Lus10005379.g ID=Lus10005379.BGIv1.0 annot-version=v1.0 ATGGTGCGCTGTTTTGGATTGCTGAGTGCGGTGCTGCTGACGGTCTTGGCTGCGTCGATGGTGGTTCTGCCGCTAATGCTGCCGCCTCTGCCTCCACCGC CGTTGATGCTCCTGTTTTTCCCGGTTGGGATAATGGCGGCTCTCATGTTCTTGGCGTTCTCTCCCTCCGATGTTGGAGCGGCTTCCGGCGCCGGCGGTGG AGGAGGAAACTTCGCCCTCCATACTCATGCCTGA
AA sequence Show only first row Show all	>Lus10005379 pacid=23155605 polypeptide=Lus10005379 locus=Lus10005379.g ID=Lus10005379.BGIv1.0 annot-version=v1.0 MVRCFGLLSAVLLTVLAASMVVLPLMLPPLPPPPLMLLFFPVGIMAALMFLAFSPSDVGAASGAGGGGGNFALHTHA

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10005379 [exp]	0	1
AT3G51680		AtSDR2	short-chain dehydrogenase/redu...		Lus10021318 [exp]	10.1	0.9483
AT4G34350		HDR, CLB6, ISPH	CHLOROPLAST BIOGENESIS 6, 4-hy...		Lus10040509 [exp]	11.4	0.9577
AT4G04480			unknown protein		Lus10020028 [exp]	15.2	0.9520
AT5G13080	WRKY	ATWRKY75, WRKY7...	ARABIDOPSIS THALIANA WRKY DNA-...		Lus10003128 [exp]	18.3	0.9468
AT1G10370		GST30B, ATGSTU1...	GLUTATHIONE S-TRANSFERASE U17,...		Lus10030805 [exp]	28.8	0.9463
AT1G73880		UGT89B1	UDP-glucosyl transferase 89B1 ...		Lus10007972 [exp]	31.6	0.9469
AT2G38740			Haloacid dehalogenase-like hyd...		Lus10030929 [exp]	32.2	0.9427
AT3G51680		AtSDR2	short-chain dehydrogenase/redu...		Lus10013594 [exp]	32.3	0.9460
AT5G56260			Ribonuclease E inhibitor RraA/...		Lus10032885 [exp]	33.7	0.9464
AT5G53560		B5#2, ATB5-A, A...	ARABIDOPSIS CYTOCHROME B5 ISOF...		Lus10022357 [exp]	36.7	0.9263

Compare expression of checked genes

Lus10005379 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.