Lus10005426 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10015230 76 / 1e-19 ND /
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10005426 pacid=23182202 polypeptide=Lus10005426 locus=Lus10005426.g ID=Lus10005426.BGIv1.0 annot-version=v1.0
ATGGAGATCAAGGCTTTCACGAAGGCCACTTTCTTTGCTATCCTCCTACCATTTGCATCAGTTGGGAACAACAACAGTGGAGCAGCAGCCGGTAGAACCA
GCGCCACAGCAGTCGCCGGTGGCATAGAGCCGCCGTGCGGACTCATTTGCCGACCAGGTTGTTTTTGCCAGGATTTTGCATGCGTTTGCCCGGAAGTTGA
ACGTCCGGTGGCTTCTGGAATTAAGAATAATGGACCAAGGAATTGA
AA sequence
>Lus10005426 pacid=23182202 polypeptide=Lus10005426 locus=Lus10005426.g ID=Lus10005426.BGIv1.0 annot-version=v1.0
MEIKAFTKATFFAILLPFASVGNNNSGAAAGRTSATAVAGGIEPPCGLICRPGCFCQDFACVCPEVERPVASGIKNNGPRN

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10005426 0 1
AT1G15170 MATE efflux family protein (.1... Lus10018135 8.1 0.7465
AT1G77760 GNR1, NIA1 nitrate reductase 1 (.1) Lus10031005 9.2 0.7282
AT5G66240 Transducin/WD40 repeat-like su... Lus10017157 15.3 0.7328
AT2G01060 GARP myb-like HTH transcriptional r... Lus10005036 19.5 0.7178
AT4G34460 ELK4, AGB1, ATA... ERECTA-LIKE 4, GTP binding pro... Lus10023579 21.0 0.6648
AT3G62200 Putative endonuclease or glyco... Lus10038949 48.0 0.6447
AT5G10630 Translation elongation factor ... Lus10026953 48.4 0.6842
Lus10034887 55.2 0.6559
AT1G13290 C2H2ZnF WIP6, DOT5 WIP domain protein 6, DEFECTIV... Lus10035044 55.7 0.6214
Lus10039165 55.8 0.6469

Lus10005426 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.