Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10006779 [exp] 90 / 1e-24 AT5G63920 42 / 2e-05 topoisomerase 3alpha (.1) Lus10039338 [exp] 69 / 1e-16 ND / Lus10003766 [exp] 65 / 1e-14 ND 36 / 0.004 Lus10032975 [exp] 64 / 2e-14 ND 40 / 1e-04 Lus10037411 [exp] 62 / 2e-12 AT2G28450 874 / 0.0 zinc finger (CCCH-type) family protein (.1), zinc finger (CCCH-type) family protein (.2) Lus10039973 [exp] 58 / 2e-12 ND / Lus10011688 [exp] 45 / 7e-07 ND / Lus10015856 [exp] 0 / 1 ND / Lus10024526 [exp] 0 / 1 AT2G40070 66 / 2e-11 unknown protein
Poplar homologues Show only best Show top 10	No hit found
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0167 [flax] [poplar] Zn_Beta_Ribbon PF06839 [flax] [poplar] zf-GRF GRF zinc finger
Representative CDS sequence Show only first row Show all	>Lus10005485 pacid=23182568 polypeptide=Lus10005485 locus=Lus10005485.g ID=Lus10005485.BGIv1.0 annot-version=v1.0 ATGGGATCCTTATCCTCTCCGAACGAAAGGAGCGGTCGGAGGTCAGGTTACCGTGTCCAATACCTACAGTTCAGGAAAGTGTTCCACGATGTAGAGGCGG TGCTGAAGGTGGCTACGACTGAAAAGAATCGTGGGCGTGCATTCTTCCAGTGCCTGTTCTGGAAGATTTCTGATTGCGGCTTCTTCGTCGGGGAATCCGA TTACCAGAAATCAGCACGAGAGGATGGAGTTCATGGAAAAGGTTTGAGGAGGCATGAAGAACCCGCAAAAAAACATGTAAATTGA
AA sequence Show only first row Show all	>Lus10005485 pacid=23182568 polypeptide=Lus10005485 locus=Lus10005485.g ID=Lus10005485.BGIv1.0 annot-version=v1.0 MGSLSSPNERSGRRSGYRVQYLQFRKVFHDVEAVLKVATTEKNRGRAFFQCLFWKISDCGFFVGESDYQKSAREDGVHGKGLRRHEEPAKKHVN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10005485 [exp]	0	1
AT3G28050			nodulin MtN21 /EamA-like trans...		Lus10039426 [exp]	8.5	0.6183
					Lus10025748 [exp]	21.8	0.6022
AT3G61780		EMB1703	embryo defective 1703 (.1)		Lus10030250 [exp]	27.6	0.4527
AT3G06240			F-box family protein (.1)		Lus10034007 [exp]	31.7	0.5267
AT4G14103			F-box/RNI-like superfamily pro...		Lus10020634 [exp]	115.7	0.4863
					Lus10026470 [exp]	149.0	0.4736
					Lus10037806 [exp]	184.7	0.4416
AT1G13570			F-box/RNI-like superfamily pro...		Lus10004852 [exp]	201.1	0.4487

Compare expression of checked genes

Lus10005485 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.