Lus10005492 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT2G20370 61 / 3e-12 AtMUR3, MUR3, KAM1 MURUS 3, KATAMARI 1, Exostosin family protein (.1)
AT4G13990 56 / 2e-10 Exostosin family protein (.1)
AT2G29040 53 / 2e-09 Exostosin family protein (.1)
AT2G32750 49 / 3e-08 Exostosin family protein (.1)
AT2G31990 49 / 4e-08 Exostosin family protein (.1)
AT5G62220 42 / 2e-05 ATGT18 glycosyltransferase 18 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10016532 138 / 5e-40 AT2G29040 546 / 0.0 Exostosin family protein (.1)
Lus10040003 81 / 7e-22 AT2G20370 48 / 4e-08 MURUS 3, KATAMARI 1, Exostosin family protein (.1)
Lus10001578 84 / 2e-20 AT2G29040 566 / 0.0 Exostosin family protein (.1)
Lus10004967 84 / 2e-20 AT2G29040 573 / 0.0 Exostosin family protein (.1)
Lus10022862 62 / 8e-13 AT2G20370 951 / 0.0 MURUS 3, KATAMARI 1, Exostosin family protein (.1)
Lus10024961 62 / 9e-13 AT2G20370 959 / 0.0 MURUS 3, KATAMARI 1, Exostosin family protein (.1)
Lus10003440 59 / 7e-12 AT2G29040 204 / 3e-63 Exostosin family protein (.1)
Lus10006694 57 / 1e-10 AT4G13990 617 / 0.0 Exostosin family protein (.1)
Lus10001028 56 / 2e-10 AT4G13990 499 / 1e-173 Exostosin family protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.009G032500 69 / 3e-15 AT2G29040 588 / 0.0 Exostosin family protein (.1)
Potri.001G321000 69 / 4e-15 AT4G13990 660 / 0.0 Exostosin family protein (.1)
Potri.014G147800 69 / 5e-15 AT4G13990 534 / 0.0 Exostosin family protein (.1)
Potri.002G256200 61 / 2e-12 AT2G20370 964 / 0.0 MURUS 3, KATAMARI 1, Exostosin family protein (.1)
Potri.015G132600 41 / 3e-05 AT5G62220 619 / 0.0 glycosyltransferase 18 (.1)
Potri.012G130700 39 / 0.0002 AT5G62220 626 / 0.0 glycosyltransferase 18 (.1)
Potri.001G105300 38 / 0.0003 AT1G63450 653 / 0.0 root hair specific 8 (.1)
Potri.003G112200 38 / 0.0004 AT4G22580 583 / 0.0 Exostosin family protein (.1)
PFAM info
Representative CDS sequence
>Lus10005492 pacid=23182569 polypeptide=Lus10005492 locus=Lus10005492.g ID=Lus10005492.BGIv1.0 annot-version=v1.0
ATGAGGGAGGAGGTGATTTGGCTGATTCCGACGGTGGTGTATGCTGATCCGCGGTCTAGATTGGAGATGTTGGAGGACGCGTTTGATCGGACGGTGAGTG
GGGTTTTGGAGAGGGTTGAAAGGGCTAGGAAGGCGATGGAGGCAGGGAGGAATTTGACGGTGACGTCGGAGAAGGAAGAGGAGAATAACTGGAAGAAGTC
GACGGCAGTTGGGGATGTTGTGCTGCATCCTTGTGATCATTTTTTTGTTAGGGAGGATGAGTATAAACCTTAG
AA sequence
>Lus10005492 pacid=23182569 polypeptide=Lus10005492 locus=Lus10005492.g ID=Lus10005492.BGIv1.0 annot-version=v1.0
MREEVIWLIPTVVYADPRSRLEMLEDAFDRTVSGVLERVERARKAMEAGRNLTVTSEKEEENNWKKSTAVGDVVLHPCDHFFVREDEYKP

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT4G13990 Exostosin family protein (.1) Lus10005492 0 1
AT1G62935 unknown protein Lus10009297 3.9 0.9227
AT4G24700 unknown protein Lus10017951 5.0 0.9025
AT4G37870 PCK1, PEPCK phosphoenolpyruvate carboxykin... Lus10019242 5.6 0.9303
AT2G25930 PYK20, ELF3 EARLY FLOWERING 3, hydroxyprol... Lus10006857 8.0 0.9296
Lus10006918 11.8 0.9218
Lus10007508 13.2 0.9218
AT3G11080 AtRLP35 receptor like protein 35 (.1) Lus10004307 14.1 0.8566
AT3G53690 RING/U-box superfamily protein... Lus10042610 14.5 0.9218
AT1G04670 unknown protein Lus10004041 15.7 0.9218
AT5G60010 ferric reductase-like transmem... Lus10019390 16.7 0.9218

Lus10005492 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.