Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G33680 92 / 5e-23 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT2G03880 83 / 4e-20 REME1 required for efficiency of mitochondrial editing 1, Pentatricopeptide repeat (PPR) superfamily protein (.1) AT3G49142 82 / 1e-19 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G61170 80 / 7e-19 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT4G33170 79 / 2e-18 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G02330 79 / 2e-18 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G20230 78 / 2e-18 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT5G39680 76 / 1e-17 EMB2744 EMBRYO DEFECTIVE 2744, Pentatricopeptide repeat (PPR) superfamily protein (.1) AT3G57430 74 / 7e-17 OTP84 ORGANELLE TRANSCRIPT PROCESSING 84, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT3G49170 74 / 8e-17 EMB2261 embryo defective 2261, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10021232 [exp] 187 / 2e-57 AT2G33680 818 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10001617 [exp] 79 / 1e-18 AT2G03880 840 / 0.0 required for efficiency of mitochondrial editing 1, Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10017298 [exp] 78 / 1e-18 AT4G02750 343 / 4e-113 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10015898 [exp] 79 / 2e-18 AT2G13600 899 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10020081 [exp] 78 / 3e-18 AT3G49710 886 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10013540 [exp] 78 / 3e-18 AT4G02750 1075 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10009269 [exp] 76 / 2e-17 AT2G13600 874 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10040577 [exp] 76 / 2e-17 AT1G25360 577 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Lus10008967 [exp] 75 / 4e-17 AT4G21300 876 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G006800 [exp] 119 / 7e-33 AT2G33680 780 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.014G012500 [exp] 87 / 2e-21 AT3G49710 995 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.004G208000 [exp] 85 / 1e-20 AT2G03880 939 / 0.0 required for efficiency of mitochondrial editing 1, Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.004G111300 [exp] 83 / 6e-20 AT3G02330 1077 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.007G104700 [exp] 82 / 8e-20 AT2G13600 834 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.002G027800 [exp] 82 / 1e-19 AT1G25360 1047 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.016G075000 [exp] 82 / 2e-19 AT2G41080 755 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.004G059400 [exp] 80 / 6e-19 AT4G18750 1110 / 0.0 DEFECTIVELY ORGANIZED TRIBUTARIES 4, Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.015G018700 [exp] 79 / 1e-18 AT3G49170 1040 / 0.0 embryo defective 2261, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Potri.012G041200 [exp] 79 / 1e-18 AT5G16860 1083 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10005642 pacid=23157210 polypeptide=Lus10005642 locus=Lus10005643.g ID=Lus10005642.BGIv1.0 annot-version=v1.0 ATGGAATTGGGATCGCAAGAATCATCTGTTTATGTACTGTTGTCAAGTATCTACAATGCCTTGCGTAGACCAAAAGAGGTGGAGAGAATCAGGAGCTTGA TGAGAAGTCGAAAAGCGAACAAAGAACCTGGTTGTAGTTGGATTGAGCTTAAGAGCCCCGTCCATGTCTTCGTGGTTGGAGATCAACGGCATCCACAGAT CGACGAAATCTGTGGCGAAATTCGTAGATTGTTCAAGAAAATGAAACATGAAGGTTACCACCCTGCACCTGACTTGGCTGCCTAA
AA sequence Show only first row Show all	>Lus10005642 pacid=23157210 polypeptide=Lus10005642 locus=Lus10005643.g ID=Lus10005642.BGIv1.0 annot-version=v1.0 MELGSQESSVYVLLSSIYNALRRPKEVERIRSLMRSRKANKEPGCSWIELKSPVHVFVVGDQRHPQIDEICGEIRRLFKKMKHEGYHPAPDLAA

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G03880		REME1	required for efficiency of mit...		Lus10005642 [exp]	0	1
AT2G33680			Tetratricopeptide repeat (TPR)...		Lus10005643 [exp]	1.0	0.8817
AT1G13630			Tetratricopeptide repeat (TPR)...		Lus10000029 [exp]	3.0	0.7631
AT1G77010			Pentatricopeptide repeat (PPR)...		Lus10010146 [exp]	4.5	0.7472
AT5G59600			Tetratricopeptide repeat (TPR)...		Lus10040778 [exp]	6.6	0.7446
AT3G56330			N2,N2-dimethylguanosine tRNA m...		Lus10012884 [exp]	14.4	0.7805
AT3G58650			unknown protein		Lus10029857 [exp]	20.9	0.7755
AT3G07330		ATCSLC6, ATCSLC...	CELLULOSE-SYNTHASE LIKE C6, Ce...		Lus10038217 [exp]	31.9	0.7618
AT3G27520			unknown protein		Lus10022283 [exp]	33.5	0.7320
AT2G40840		DPE2	disproportionating enzyme 2 (....		Lus10031010 [exp]	65.7	0.7389
AT5G14950		GMII, ATGMII	golgi alpha-mannosidase II (.1...		Lus10014507 [exp]	69.2	0.7216

Compare expression of checked genes

Lus10005642 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.