Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G06900 77 / 3e-17 CYP93D1 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) AT3G44250 74 / 2e-16 CYP71B38 "cytochrome P450, family 71, subfamily B, polypeptide 38", cytochrome P450, family 71, subfamily B, polypeptide 38 (.1) AT5G07990 72 / 1e-15 CYP75B1, D501, TT7 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) AT2G45560 70 / 5e-15 CYP76C1 "cytochrome P450, family 76, subfamily C, polypeptide 1", cytochrome P450, family 76, subfamily C, polypeptide 1 (.1.2) AT3G48280 70 / 5e-15 CYP71A25 "cytochrome P450, family 71, subfamily A, polypeptide 25", cytochrome P450, family 71, subfamily A, polypeptide 25 (.1) AT3G53280 70 / 6e-15 CYP71B5 cytochrome p450 71b5 (.1) AT4G12300 70 / 8e-15 CYP706A4 "cytochrome P450, family 706, subfamily A, polypeptide 4", cytochrome P450, family 706, subfamily A, polypeptide 4 (.1) AT5G04330 69 / 1e-14 Cytochrome P450 superfamily protein (.1) AT4G13290 69 / 2e-14 CYP71A19 "cytochrome P450, family 71, subfamily A, polypeptide 19", cytochrome P450, family 71, subfamily A, polypeptide 19 (.1) AT4G13310 68 / 2e-14 CYP71A20 "cytochrome P450, family 71, subfamily A, polypeptide 20", cytochrome P450, family 71, subfamily A, polypeptide 20 (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10005878 [exp] 174 / 4e-53 AT5G06900 440 / 1e-150 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Lus10040868 [exp] 167 / 1e-50 AT5G06900 434 / 5e-148 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Lus10035502 [exp] 89 / 2e-21 AT5G06900 533 / 0.0 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Lus10033172 [exp] 79 / 6e-18 AT4G31500 540 / 0.0 SUPERROOT 2, RUNT 1, RED ELONGATED 1, "cytochrome P450, family 83, subfamily B, polypeptide 1", ALTERED TRYPTOPHAN REGULATION 4, cytochrome P450, family 83, subfamily B, polypeptide 1 (.1) Lus10030687 [exp] 76 / 2e-17 AT5G06900 244 / 1e-77 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Lus10038796 [exp] 76 / 5e-17 AT3G26300 364 / 5e-121 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1) Lus10009909 [exp] 76 / 6e-17 AT5G10600 481 / 2e-166 "cytochrome P450, family 81, subfamily K, polypeptide 2", cytochrome P450, family 81, subfamily K, polypeptide 2 (.1) Lus10030530 [exp] 74 / 2e-16 AT3G48310 191 / 1e-56 "cytochrome P450, family 71, subfamily A, polypeptide 22", cytochrome P450, family 71, subfamily A, polypeptide 22 (.1) Lus10019157 [exp] 74 / 3e-16 AT3G48300 358 / 1e-118 "cytochrome P450, family 71, subfamily A, polypeptide 23", cytochrome P450, family 71, subfamily A, polypeptide 23 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G027000 [exp] 94 / 2e-23 AT5G06900 357 / 3e-118 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Potri.016G049800 [exp] 92 / 1e-22 AT5G06900 536 / 0.0 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Potri.005G037201 [exp] 89 / 1e-21 AT5G06900 382 / 6e-128 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Potri.005G037100 [exp] 89 / 2e-21 AT5G06900 383 / 4e-128 "cytochrome P450, family 93, subfamily D, polypeptide 1", cytochrome P450, family 93, subfamily D, polypeptide 1 (.1) Potri.007G085000 [exp] 81 / 1e-18 AT5G07990 402 / 5e-135 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.007G084200 [exp] 80 / 2e-18 AT3G26300 385 / 1e-129 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1) Potri.007G084700 [exp] 80 / 2e-18 AT5G07990 397 / 5e-134 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.007G074300 [exp] 79 / 6e-18 AT3G26300 343 / 6e-113 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1) Potri.011G131051 [exp] 78 / 6e-18 AT3G48280 218 / 9e-67 "cytochrome P450, family 71, subfamily A, polypeptide 25", cytochrome P450, family 71, subfamily A, polypeptide 25 (.1) Potri.008G223500 [exp] 77 / 2e-17 AT3G26300 395 / 3e-133 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF00067 [flax] [poplar] p450 Cytochrome P450
Representative CDS sequence Show only first row Show all	>Lus10005879 pacid=23176904 polypeptide=Lus10005879 locus=Lus10005879.g ID=Lus10005879.BGIv1.0 annot-version=v1.0 ATGCTCACCATGATCGTCGAGCTTCTCTCCCTCCTAGCCATACTCGCCTTCTTCGCCCTAACCCTAGCTCGAAATGCACGAAACAACAAAGACCTCCCTC CGGGACCCATGTCCCTTCCGGTCATCGGCCATCTCCACCTCATCGGACCACTAATCCACCACACTTTCCACGACCTCGCCTCACGCTATGGCCCGCTCAT GAACATCAAGCTCGGCTCCATCTCGGCCATCGTGGTCTCCTCTCCGGACCTGGCTCGCGAATTCCTCAAAACCCACGAGATCAACTTCTCGATGCGGGCC AGCACCATTGCCATCGACTACCTCACCTACAACAACATCTCCTTCGCCTTCGCACCCTACGGGCACATCACTGTGAAATAA
AA sequence Show only first row Show all	>Lus10005879 pacid=23176904 polypeptide=Lus10005879 locus=Lus10005879.g ID=Lus10005879.BGIv1.0 annot-version=v1.0 MLTMIVELLSLLAILAFFALTLARNARNNKDLPPGPMSLPVIGHLHLIGPLIHHTFHDLASRYGPLMNIKLGSISAIVVSSPDLAREFLKTHEINFSMRA STIAIDYLTYNNISFAFAPYGHITVK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G06900		CYP93D1	"cytochrome P450, family 93, s...		Lus10005879 [exp]	0	1
AT1G01420		UGT72B3	UDP-glucosyl transferase 72B3 ...		Lus10001905 [exp]	1.4	0.9335
AT1G67290		GLOX1	glyoxal oxidase 1, glyoxal oxi...		Lus10012981 [exp]	2.0	0.9217
AT1G67290		GLOX1	glyoxal oxidase 1, glyoxal oxi...		Lus10012980 [exp]	2.4	0.9177
AT1G67290		GLOX1	glyoxal oxidase 1, glyoxal oxi...		Lus10034959 [exp]	2.6	0.8706
AT5G06900		CYP93D1	"cytochrome P450, family 93, s...		Lus10005878 [exp]	2.8	0.9162
					Lus10004594 [exp]	3.7	0.8514
AT3G11170		AtFAD7, FADD, F...	FATTY ACID DESATURASE D, fatty...		Lus10018245 [exp]	5.2	0.8659
AT1G69320		CLE10	CLAVATA3/ESR-RELATED 10 (.1)		Lus10036960 [exp]	6.2	0.8344
AT4G15210		BAM5, AT-BETA-A...	REDUCED BETA AMYLASE 1, ARABID...		Lus10018491 [exp]	6.3	0.8698
AT1G09790		COBL6	COBRA-like protein 6 precursor...		Lus10010097 [exp]	6.5	0.8763

Compare expression of checked genes

Lus10005879 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.