Plant FIBer expression Database

Lus10006131 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G19740 176 / 1e-56 ATP-dependent protease La (LON) domain protein (.1)
AT1G75460 175 / 2e-56 ATP-dependent protease La (LON) domain protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10024294
[exp]
193 / 8e-65 AT1G75460 313 / 2e-109 ATP-dependent protease La (LON) domain protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.002G029900
[exp]
186 / 2e-60 AT1G75460 373 / 3e-131 ATP-dependent protease La (LON) domain protein (.1)
Potri.005G232800
[exp]
177 / 5e-57 AT1G75460 366 / 2e-128 ATP-dependent protease La (LON) domain protein (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0178 PUA PF02190 LON_substr_bdg ATP-dependent protease La (LON) substrate-binding domain
Representative CDS sequence
>Lus10006131 pacid=23148020 polypeptide=Lus10006131 locus=Lus10006131.g ID=Lus10006131.BGIv1.0 annot-version=v1.0
ATGGATGAGTTGGCGACGGAGGTTGAGACGTATATGAAGGATGTAATCAGGTTGTCGAATCGTCTGAACGGGAAGCCGGATAAAGAGGCCCAGGACCTGC
GGAGGAATCTGTTTCCGACGCCGTTTTCCTTCTTCGTCGGGAGTACGTTCGAAGGCGCGCCGAGGGAGCAGCAGGCTTTGCTGGAGTTGGAAGACACGGC
TGCGAGATTGAAGCGGGAGAAAGAGACGTTGAGGAACACGTTGAATTACTTGACCGCCGCTTCAGCAGTTAAAGACGTATTTCCTTCTTCCTGA
AA sequence
>Lus10006131 pacid=23148020 polypeptide=Lus10006131 locus=Lus10006131.g ID=Lus10006131.BGIv1.0 annot-version=v1.0
MDELATEVETYMKDVIRLSNRLNGKPDKEAQDLRRNLFPTPFSFFVGSTFEGAPREQQALLELEDTAARLKREKETLRNTLNYLTAASAVKDVFPSS

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT1G19740 ATP-dependent protease La (LON... Lus10006131
[exp]
0 1
AT3G27830 RPL12-A ribosomal protein L12-A (.1) Lus10013078
[exp]
1.0 0.9442
AT4G20360 AtRab8D, AtRABE... RAB GTPase homolog E1B (.1) Lus10019493
[exp]
2.8 0.9418
AT3G27850 RPL12-C ribosomal protein L12-C (.1) Lus10022261
[exp]
3.5 0.9353
AT4G14870 SECE1 secE/sec61-gamma protein trans... Lus10010555
[exp]
4.1 0.9205
AT1G74470 Pyridine nucleotide-disulphide... Lus10001642
[exp]
5.0 0.9372
AT2G30570 PSBW photosystem II reaction center... Lus10014751
[exp]
5.2 0.9388
AT3G27750 EMB3123 EMBRYO DEFECTIVE 3123, unknown... Lus10038297
[exp]
5.4 0.9154
AT4G20360 AtRab8D, AtRABE... RAB GTPase homolog E1B (.1) Lus10043342
[exp]
7.0 0.9332
AT3G46780 PTAC16 plastid transcriptionally acti... Lus10016502
[exp]
7.7 0.9381
AT4G25910 ATCNFU3, NFU3 NFU domain protein 3 (.1) Lus10001634
[exp]
9.4 0.9314

Lus10006131 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.