Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G67660 146 / 1e-44 Restriction endonuclease, type II-like superfamily protein (.1.2.3) AT1G13810 70 / 2e-15 Restriction endonuclease, type II-like superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011377 [exp] 204 / 1e-69 AT1G67660 169 / 1e-53 Restriction endonuclease, type II-like superfamily protein (.1.2.3) Lus10012108 [exp] 78 / 2e-19 AT1G13810 113 / 2e-31 Restriction endonuclease, type II-like superfamily protein (.1) Lus10010434 [exp] 79 / 1e-18 AT1G13810 216 / 5e-68 Restriction endonuclease, type II-like superfamily protein (.1) Lus10017632 [exp] 79 / 2e-18 AT1G13810 216 / 6e-69 Restriction endonuclease, type II-like superfamily protein (.1) Lus10033589 [exp] 56 / 3e-10 AT1G13810 161 / 4e-45 Restriction endonuclease, type II-like superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G054800 [exp] 168 / 4e-52 AT1G67660 391 / 7e-136 Restriction endonuclease, type II-like superfamily protein (.1.2.3) Potri.010G222500 [exp] 83 / 6e-20 AT1G13810 242 / 1e-78 Restriction endonuclease, type II-like superfamily protein (.1) Potri.008G039800 [exp] 60 / 3e-12 AT1G13810 143 / 2e-42 Restriction endonuclease, type II-like superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10006437 pacid=23172002 polypeptide=Lus10006437 locus=Lus10006437.g ID=Lus10006437.BGIv1.0 annot-version=v1.0 ATGCCTTTCTACTACATGCCTCAGGTGCAAGGCCAGCTCGAGATCATGGACCGGGAATGGGCGGATCTGTACTGCTGGACTCCGAATGGGAGCACAATTT TTCGCGTTCCAAGGGATCCGGGTTACTGGAATATTATAAGCAAGATACTGGAAGATTTCTGGTGGGGGGATGTGATTCCTGCTAGGGAAGCTCTCTTGGC TGGGAAAGAAGAAGAGGCCAAGTCTTTTATGCCGACTTCGACTCACAATCGCACCGGGCTCGCCATTTCCAGGAGCATTAAGTTGGCTGCTGAGTGCAAG CTTCAGTGTCGAGAGATTGCCGGACATGTCGAATTCTTCCTGTAA
AA sequence Show only first row Show all	>Lus10006437 pacid=23172002 polypeptide=Lus10006437 locus=Lus10006437.g ID=Lus10006437.BGIv1.0 annot-version=v1.0 MPFYYMPQVQGQLEIMDREWADLYCWTPNGSTIFRVPRDPGYWNIISKILEDFWWGDVIPAREALLAGKEEEAKSFMPTSTHNRTGLAISRSIKLAAECK LQCREIAGHVEFFL

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G67660			Restriction endonuclease, type...		Lus10006437 [exp]	0	1
AT1G67660			Restriction endonuclease, type...		Lus10011377 [exp]	1.0	0.8777
AT3G46790		CRR2	CHLORORESPIRATORY REDUCTION 2,...		Lus10004987 [exp]	3.7	0.8254
AT5G50250		CP31B	chloroplast RNA-binding protei...		Lus10041952 [exp]	3.7	0.8470
AT4G33030		SQD1	sulfoquinovosyldiacylglycerol ...		Lus10013513 [exp]	7.9	0.8387
AT1G02560		NCLPP5, NCLPP1,...	NUCLEAR CLPP 5, NUCLEAR-ENCODE...		Lus10002422 [exp]	8.2	0.8315
AT5G13120		Pnsl5, ATCYP20-...	Photosynthetic NDH subcomplex...		Lus10003138 [exp]	8.7	0.8022
AT2G33250			unknown protein		Lus10023703 [exp]	11.2	0.8034
AT2G44650		CHL-CPN10	chloroplast chaperonin 10 (.1)		Lus10043345 [exp]	12.7	0.7889
AT1G11430			plastid developmental protein ...		Lus10007615 [exp]	15.3	0.8281
AT2G17033			pentatricopeptide (PPR) repeat...		Lus10025090 [exp]	18.0	0.7440

Compare expression of checked genes

Lus10006437 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.