Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G29420 62 / 2e-13 SAUR-like auxin-responsive protein family (.1) AT1G29460 61 / 5e-13 SAUR-like auxin-responsive protein family (.1) AT5G27780 61 / 9e-13 SAUR-like auxin-responsive protein family (.1) AT1G29510 59 / 3e-12 SAUR68 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) AT1G29430 59 / 3e-12 SAUR-like auxin-responsive protein family (.1) AT1G29490 58 / 4e-12 SAUR-like auxin-responsive protein family (.1) AT1G29440 58 / 6e-12 SAUR-like auxin-responsive protein family (.1) AT1G29500 57 / 1e-11 SAUR-like auxin-responsive protein family (.1) AT1G29450 56 / 5e-11 SAUR-like auxin-responsive protein family (.1) AT4G09530 52 / 6e-10 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10020439 [exp] 167 / 3e-55 AT1G29510 67 / 5e-15 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Lus10007060 [exp] 100 / 2e-28 AT1G29430 71 / 2e-16 SAUR-like auxin-responsive protein family (.1) Lus10020440 [exp] 100 / 2e-28 AT1G29430 72 / 3e-17 SAUR-like auxin-responsive protein family (.1) Lus10007069 [exp] 98 / 9e-28 AT1G29430 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10007067 [exp] 98 / 1e-27 AT1G29430 69 / 4e-16 SAUR-like auxin-responsive protein family (.1) Lus10020432 [exp] 96 / 7e-27 AT1G20470 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10020441 [exp] 95 / 1e-26 AT1G29430 71 / 4e-17 SAUR-like auxin-responsive protein family (.1) Lus10007068 [exp] 94 / 6e-26 AT1G29510 68 / 1e-15 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Lus10020430 [exp] 76 / 5e-19 AT1G29460 66 / 5e-15 SAUR-like auxin-responsive protein family (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G181400 [exp] 71 / 8e-17 AT1G29450 132 / 4e-40 SAUR-like auxin-responsive protein family (.1) Potri.009G141201 [exp] 69 / 4e-16 AT5G27780 132 / 3e-40 SAUR-like auxin-responsive protein family (.1) Potri.017G043400 [exp] 69 / 8e-16 AT5G27780 141 / 8e-44 SAUR-like auxin-responsive protein family (.1) Potri.009G140900 [exp] 66 / 5e-15 AT1G29510 139 / 3e-43 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.002G064300 [exp] 66 / 7e-15 AT1G29510 109 / 2e-31 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.009G141150 [exp] 63 / 8e-14 AT1G29450 131 / 5e-40 SAUR-like auxin-responsive protein family (.1) Potri.017G043500 [exp] 63 / 1e-13 AT5G27780 120 / 1e-35 SAUR-like auxin-responsive protein family (.1) Potri.009G141251 [exp] 62 / 2e-13 AT1G29430 93 / 7e-25 SAUR-like auxin-responsive protein family (.1) Potri.005G196850 [exp] 62 / 1e-12 AT1G29510 102 / 2e-27 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.013G111000 [exp] 55 / 2e-11 AT4G09530 93 / 3e-26 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [flax] [poplar] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Lus10007066 pacid=23153253 polypeptide=Lus10007066 locus=Lus10007066.g ID=Lus10007066.BGIv1.0 annot-version=v1.0 ATGAGAACTCTCGTAAGGCTAACGATGCGAAAATGGAGGCAAATTGAAGCAATGAGAAGAATGCGTTCTGTTTCTTCTCCTTCTTCTTCTTCCTCAACAT CATCCCTTTGCTCTTGGAATAATTATAGCAAGGATGGTCATTTTGTGGTTTACAGTATGGACAAAAGCCGGTTTGTGATACCGTTGAAGTTTCTGGAAAG TGGAATTATAGTGGAATTACTGAAGATGTCAGAAGATGAGTTTGGATTCTCCAACGATACAATAGTGCTGCCATTTGAATCTTGTACCATGAACCAGATC GTTAGGTTTCTCTCGTCCAGGCAATAA
AA sequence Show only first row Show all	>Lus10007066 pacid=23153253 polypeptide=Lus10007066 locus=Lus10007066.g ID=Lus10007066.BGIv1.0 annot-version=v1.0 MRTLVRLTMRKWRQIEAMRRMRSVSSPSSSSSTSSLCSWNNYSKDGHFVVYSMDKSRFVIPLKFLESGIIVELLKMSEDEFGFSNDTIVLPFESCTMNQI VRFLSSRQ

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G29430			SAUR-like auxin-responsive pro...		Lus10007066 [exp]	0	1
AT4G09900		ATMES12	ARABIDOPSIS THALIANA METHYL ES...		Lus10009489 [exp]	3.2	0.8891
AT2G34730			myosin heavy chain-related (.1...		Lus10038540 [exp]	4.5	0.8268
AT3G28540			P-loop containing nucleoside t...		Lus10007270 [exp]	11.5	0.8713
AT5G67360		ARA12	Subtilase family protein (.1)		Lus10006303 [exp]	13.1	0.8654
AT5G17540			HXXXD-type acyl-transferase fa...		Lus10020330 [exp]	15.3	0.8690
AT3G44900		ATCHX4	cation/H+ exchanger 4, cation/...		Lus10032621 [exp]	17.6	0.8631
AT5G13990		ATEXO70C2	exocyst subunit exo70 family p...		Lus10041536 [exp]	23.4	0.8561
					Lus10041941 [exp]	25.9	0.8322
					Lus10039496 [exp]	26.1	0.8539
AT2G26695			Ran BP2/NZF zinc finger-like s...		Lus10033023 [exp]	28.1	0.7721

Compare expression of checked genes

Lus10007066 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.