Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G29510 68 / 8e-16 SAUR68 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) AT1G29430 67 / 3e-15 SAUR-like auxin-responsive protein family (.1) AT1G76190 63 / 5e-14 SAUR-like auxin-responsive protein family (.1) AT5G27780 63 / 9e-14 SAUR-like auxin-responsive protein family (.1) AT1G29420 63 / 1e-13 SAUR-like auxin-responsive protein family (.1) AT1G29490 62 / 1e-13 SAUR-like auxin-responsive protein family (.1) AT1G29440 61 / 4e-13 SAUR-like auxin-responsive protein family (.1) AT1G20470 60 / 2e-12 SAUR-like auxin-responsive protein family (.1) AT1G29460 60 / 2e-12 SAUR-like auxin-responsive protein family (.1) AT1G29450 59 / 3e-12 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007069 [exp] 199 / 1e-67 AT1G29430 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10020440 [exp] 192 / 8e-65 AT1G29430 72 / 3e-17 SAUR-like auxin-responsive protein family (.1) Lus10007067 [exp] 183 / 1e-61 AT1G29430 69 / 4e-16 SAUR-like auxin-responsive protein family (.1) Lus10020441 [exp] 180 / 2e-60 AT1G29430 71 / 4e-17 SAUR-like auxin-responsive protein family (.1) Lus10007060 [exp] 110 / 3e-32 AT1G29430 71 / 2e-16 SAUR-like auxin-responsive protein family (.1) Lus10020439 [exp] 110 / 3e-32 AT1G29510 67 / 5e-15 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Lus10020432 [exp] 99 / 6e-28 AT1G20470 69 / 3e-16 SAUR-like auxin-responsive protein family (.1) Lus10007066 [exp] 94 / 4e-26 AT1G29430 66 / 5e-15 SAUR-like auxin-responsive protein family (.1) Lus10020430 [exp] 83 / 6e-22 AT1G29460 66 / 5e-15 SAUR-like auxin-responsive protein family (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G141251 [exp] 72 / 3e-17 AT1G29430 93 / 7e-25 SAUR-like auxin-responsive protein family (.1) Potri.017G043400 [exp] 71 / 1e-16 AT5G27780 141 / 8e-44 SAUR-like auxin-responsive protein family (.1) Potri.017G043500 [exp] 69 / 8e-16 AT5G27780 120 / 1e-35 SAUR-like auxin-responsive protein family (.1) Potri.004G181400 [exp] 68 / 1e-15 AT1G29450 132 / 4e-40 SAUR-like auxin-responsive protein family (.1) Potri.002G064300 [exp] 67 / 5e-15 AT1G29510 109 / 2e-31 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.009G141201 [exp] 66 / 9e-15 AT5G27780 132 / 3e-40 SAUR-like auxin-responsive protein family (.1) Potri.009G141150 [exp] 64 / 3e-14 AT1G29450 131 / 5e-40 SAUR-like auxin-responsive protein family (.1) Potri.005G196850 [exp] 65 / 6e-14 AT1G29510 102 / 2e-27 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.009G141100 [exp] 64 / 6e-14 AT1G29510 117 / 8e-35 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1) Potri.009G140900 [exp] 58 / 1e-11 AT1G29510 139 / 3e-43 SMALL AUXIN UPREGULATED 68, SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [flax] [poplar] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Lus10007068 pacid=23153260 polypeptide=Lus10007068 locus=Lus10007068.g ID=Lus10007068.BGIv1.0 annot-version=v1.0 ATGGCTCTTTCGAAAGCTCCGACGATGATCAGAAGGATGAGGTTTGCTTCTTCTTCTTCGAATGTCGACAATAAGGGTGGTCATTTTGTGGTTTACAGCA TGGATAATGTTCGGTTTGTTATACCGTTGAAGCTTTTGAAGAGTAAAATCATTGTGGAATTGTTGAAGATGGCAGAAGATGAGTTTGGATTCTCAAGCGA ACAACCGATCGTGTTTCCATTCGAATCAAGTATCATGAACCAGATTATCATGCATCTCTCGACGTCCCGCCAGCAAGCGAACACCAGCTTGAGCAACCAC GTACATTCTCTTGCACAATTTGAAGTATAG
AA sequence Show only first row Show all	>Lus10007068 pacid=23153260 polypeptide=Lus10007068 locus=Lus10007068.g ID=Lus10007068.BGIv1.0 annot-version=v1.0 MALSKAPTMIRRMRFASSSSNVDNKGGHFVVYSMDNVRFVIPLKLLKSKIIVELLKMAEDEFGFSSEQPIVFPFESSIMNQIIMHLSTSRQQANTSLSNH VHSLAQFEV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G29510		SAUR68	SMALL AUXIN UPREGULATED 68, SA...		Lus10007068 [exp]	0	1
					Lus10039716 [exp]	1.0	0.9225
AT2G36780			UDP-Glycosyltransferase superf...		Lus10014403 [exp]	2.0	0.7863
AT1G69120	MADS	AGL7, AP1	APETALA1, AGAMOUS-like 7, K-bo...		Lus10005081 [exp]	18.6	0.7790
AT1G69120	MADS	AGL7, AP1	APETALA1, AGAMOUS-like 7, K-bo...		Lus10034370 [exp]	25.6	0.7440
AT3G18960	B3		AP2/B3-like transcriptional fa...		Lus10027943 [exp]	28.4	0.7377
AT2G02340		ATPP2-B8	phloem protein 2-B8 (.1)		Lus10025662 [exp]	31.6	0.7343
AT3G18990	B3	REM39, VRN1	REDUCED VERNALIZATION RESPONSE...		Lus10022473 [exp]	34.1	0.7343
AT4G10950			SGNH hydrolase-type esterase s...		Lus10023070 [exp]	36.4	0.7343
AT1G34575			FAD-binding Berberine family p...		Lus10023373 [exp]	38.7	0.7343
AT3G51590		LTP12	lipid transfer protein 12 (.1)		Lus10004067 [exp]	40.7	0.7343

Compare expression of checked genes

Lus10007068 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.