Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G33640 131 / 1e-41 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10020463 [exp] 162 / 2e-53 AT4G33640 135 / 3e-43 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G116400 [exp] 133 / 3e-42 AT4G33640 132 / 9e-42 unknown protein Potri.017G042432 [exp] 96 / 3e-27 AT4G33640 112 / 8e-34 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10007087 pacid=23153248 polypeptide=Lus10007087 locus=Lus10007087.g ID=Lus10007087.BGIv1.0 annot-version=v1.0 ATGAATGTAGCAGAAGAGGTGGAGCGCCTTAAAGATGAGATCCACAGACTCGGCACCACCACCCCCGATGGTTCCTTCAAGGTGACGTTTGGAGTGTTGT TCCATGACGAAAGGTGCGCCAACATCTTCGAAGCGTTAGTGGGAACACTGAGGGCAGCAAAGAAGAGGAAAATAGTAGCCTACGATGGGGAGCTGCTTCT TCAAGGAGTTCATGACAATGTAGAGATCACTCTTCTCCAACCTCCTACTACTCCCTCCGCCGATGCAACCACTCCCCCAGCCGCAGTTTGA
AA sequence Show only first row Show all	>Lus10007087 pacid=23153248 polypeptide=Lus10007087 locus=Lus10007087.g ID=Lus10007087.BGIv1.0 annot-version=v1.0 MNVAEEVERLKDEIHRLGTTTPDGSFKVTFGVLFHDERCANIFEALVGTLRAAKKRKIVAYDGELLLQGVHDNVEITLLQPPTTPSADATTPPAAV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G33640			unknown protein		Lus10007087 [exp]	0	1
AT3G02700			NC domain-containing protein-r...		Lus10010962 [exp]	1.0	0.9422
AT5G14670		ATARFA1B	ADP-ribosylation factor A1B (....		Lus10030884 [exp]	1.7	0.9181
AT4G10840			Tetratricopeptide repeat (TPR)...		Lus10003201 [exp]	2.8	0.9301
AT4G33640			unknown protein		Lus10020463 [exp]	2.8	0.8946
AT4G17100			unknown protein		Lus10040133 [exp]	3.0	0.8912
AT3G61460		BRH1	brassinosteroid-responsive RIN...		Lus10032290 [exp]	3.2	0.9012
AT1G07410		ATRAB-A2B, AtRA...	ARABIDOPSIS RAB GTPASE HOMOLOG...		Lus10040745 [exp]	3.3	0.8833
AT1G05850		CTL1, HOT2, ERH...	POM-POM1, SENSITIVE TO HOT TEM...		Lus10037430 [exp]	6.9	0.8833
AT1G76180		ERD14	EARLY RESPONSE TO DEHYDRATION ...		Lus10021827 [exp]	6.9	0.8997
AT4G10840			Tetratricopeptide repeat (TPR)...		Lus10017304 [exp]	7.2	0.9100

Compare expression of checked genes

Lus10007087 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.