Lus10007306 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G45750 387 / 5e-139 AtRABA1c RAB GTPase homolog A1C (.1)
AT4G18800 387 / 5e-139 AthSGBP, AtRab11B, AtRABA1d RAB GTPase homolog A1D (.1)
AT1G16920 367 / 5e-131 ATRABA4B, RAB11, ATRABA1B RAB GTPase homolog A1B (.1)
AT5G60860 353 / 2e-125 AtRABA1f RAB GTPase homolog A1F (.1)
AT1G06400 352 / 7e-125 ARA2, AtRABA1a, AtRab11E, Ara-2 ARABIDOPSIS THALIANA RAB GTPASE HOMOLOG A1A, Ras-related small GTP-binding family protein (.1)
AT3G15060 352 / 9e-125 AtRABA1g RAB GTPase homolog A1G (.1)
AT1G28550 348 / 2e-123 AtRABA1i RAB GTPase homolog A1I (.1)
AT2G33870 345 / 4e-122 ArRABA1h RAB GTPase homolog A1H (.1)
AT4G18430 338 / 3e-119 AtRABA1e RAB GTPase homolog A1E (.1)
AT1G07410 304 / 4e-106 ATRAB-A2B, AtRABA2b ARABIDOPSIS RAB GTPASE HOMOLOG A2B, RAB GTPase homolog A2B (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10029253 441 / 6e-160 AT5G45750 393 / 4e-141 RAB GTPase homolog A1C (.1)
Lus10002178 358 / 2e-127 AT5G60860 423 / 4e-153 RAB GTPase homolog A1F (.1)
Lus10017679 358 / 4e-127 AT5G60860 426 / 4e-154 RAB GTPase homolog A1F (.1)
Lus10015297 353 / 2e-125 AT5G60860 428 / 6e-155 RAB GTPase homolog A1F (.1)
Lus10025432 353 / 2e-125 AT5G60860 422 / 1e-152 RAB GTPase homolog A1F (.1)
Lus10013961 348 / 2e-123 AT5G60860 412 / 7e-149 RAB GTPase homolog A1F (.1)
Lus10020746 345 / 3e-122 AT1G06400 375 / 3e-134 ARABIDOPSIS THALIANA RAB GTPASE HOMOLOG A1A, Ras-related small GTP-binding family protein (.1)
Lus10029789 345 / 4e-122 AT1G06400 373 / 3e-133 ARABIDOPSIS THALIANA RAB GTPASE HOMOLOG A1A, Ras-related small GTP-binding family protein (.1)
Lus10039895 328 / 1e-115 AT5G60860 397 / 5e-143 RAB GTPase homolog A1F (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.004G061000 404 / 1e-145 AT4G18800 392 / 9e-141 RAB GTPase homolog A1D (.1)
Potri.011G070300 402 / 1e-144 AT5G45750 392 / 1e-140 RAB GTPase homolog A1C (.1)
Potri.001G374000 359 / 1e-127 AT5G60860 417 / 1e-150 RAB GTPase homolog A1F (.1)
Potri.019G092500 357 / 4e-127 AT5G60860 419 / 2e-151 RAB GTPase homolog A1F (.1)
Potri.011G061300 355 / 2e-126 AT5G60860 416 / 5e-150 RAB GTPase homolog A1F (.1)
Potri.013G123600 353 / 2e-125 AT5G60860 419 / 2e-151 RAB GTPase homolog A1F (.1)
Potri.006G000300 305 / 2e-106 AT1G07410 400 / 4e-144 ARABIDOPSIS RAB GTPASE HOMOLOG A2B, RAB GTPase homolog A2B (.1)
Potri.016G000400 297 / 3e-103 AT1G07410 380 / 4e-136 ARABIDOPSIS RAB GTPASE HOMOLOG A2B, RAB GTPase homolog A2B (.1)
Potri.010G197200 295 / 2e-102 AT1G07410 370 / 3e-132 ARABIDOPSIS RAB GTPASE HOMOLOG A2B, RAB GTPase homolog A2B (.1)
Potri.003G004100 293 / 8e-102 AT1G09630 382 / 6e-137 ARABIDOPSIS RAB GTPASE A2A, RAB GTPase 11C (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0023 P-loop_NTPase PF00071 Ras Ras family
Representative CDS sequence
>Lus10007306 pacid=23142496 polypeptide=Lus10007306 locus=Lus10007306.g ID=Lus10007306.BGIv1.0 annot-version=v1.0
ATGGCTAGTTACAGAGCTGAAGATGACTACGACTACCTCTTCAAAGCGGTCCTTATAGGCGATTTAGGCGTCGGCAAGTCCAATCTCCTCTCCAGATTCA
CCCGCAACGAGTTCAGCCTCGAATCCAAGTCCACCATTGGCGTCGAGTTCGCTACCCGAAGCTTGACTGTTGATTCCAAGGTCATCAAGGCCCAGATTTG
GGACACCGCTGGCCAAGAAAGGTATCGAGCCATAACCAGTGCTTATTACCGGGGAGCAGTGGGGGCACTACTAGTCTATGATGTCACTCGACACGCCACA
TTCGAGAACACCGAGAGGTGGCTAAAGGAGCTGAGGGACCACACCGACCCCAACATCGTGGTCATGCTGGTCGGCAACAAGTCAGACCTACGCCACCTTG
TGGCAGTCTCCACCGAGGATGGAAAATCCTTTGCAGAGAGGGAGTCACTCTACTTCATGGAAACCTCAGCGCTTGAAGCCATCAATGTGGAGAATGCGTT
TGCTGAGGTGCTGACTCAGATACACAGCGTGGTTAGCAAGAAGGCCATGGAGGCTGGAGAAGATGGATCTGGTTCGAACCTGCCCTCGAAAGGGGAGAAG
ATTGATGTGAGTAAAGATGTTTCTGCTGTTAAGAAAGCAGGGTGCTGCTCCAGTTAA
AA sequence
>Lus10007306 pacid=23142496 polypeptide=Lus10007306 locus=Lus10007306.g ID=Lus10007306.BGIv1.0 annot-version=v1.0
MASYRAEDDYDYLFKAVLIGDLGVGKSNLLSRFTRNEFSLESKSTIGVEFATRSLTVDSKVIKAQIWDTAGQERYRAITSAYYRGAVGALLVYDVTRHAT
FENTERWLKELRDHTDPNIVVMLVGNKSDLRHLVAVSTEDGKSFAERESLYFMETSALEAINVENAFAEVLTQIHSVVSKKAMEAGEDGSGSNLPSKGEK
IDVSKDVSAVKKAGCCSS

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT5G45750 AtRABA1c RAB GTPase homolog A1C (.1) Lus10007306 0 1
AT5G45750 AtRABA1c RAB GTPase homolog A1C (.1) Lus10029253 1.4 0.8957
AT1G06850 bZIP ATBZIP52 basic leucine-zipper 52 (.1.2) Lus10024204 4.0 0.8521
AT1G26355 SP1L1 SPIRAL1-like1 (.1) Lus10034675 6.9 0.8417
AT3G25700 Eukaryotic aspartyl protease f... Lus10041494 8.4 0.8320
AT5G10160 Thioesterase superfamily prote... Lus10020419 8.4 0.8250
AT1G62981 Protein of unknown function (D... Lus10024481 8.5 0.8477
AT1G70370 PG2 polygalacturonase 2 (.1.2) Lus10029156 13.0 0.7924
AT1G08500 AtENODL18 early nodulin-like protein 18 ... Lus10037998 15.3 0.7836
AT4G12420 SKU5 Cupredoxin superfamily protein... Lus10024604 15.7 0.8272
AT5G48660 B-cell receptor-associated pro... Lus10022777 22.0 0.7755

Lus10007306 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.