Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G42840 132 / 3e-39 PDF1 protodermal factor 1 (.1) AT2G20515 40 / 3e-05 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007351 [exp] 207 / 1e-68 AT2G42840 170 / 5e-51 protodermal factor 1 (.1) Lus10031390 [exp] 160 / 3e-50 AT2G42840 / protodermal factor 1 (.1) Lus10010941 [exp] 160 / 5e-50 AT2G42840 169 / 2e-50 protodermal factor 1 (.1) Lus10022928 [exp] 42 / 1e-05 AT2G20515 173 / 3e-56 unknown protein Lus10024890 [exp] 39 / 0.0002 AT2G20515 154 / 2e-48 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G200900 [exp] 164 / 9e-52 AT2G42840 163 / 4e-48 protodermal factor 1 (.1) Potri.002G060800 [exp] 161 / 7e-51 AT2G42840 167 / 4e-50 protodermal factor 1 (.1) Potri.005G224600 [exp] 52 / 2e-09 AT2G20515 177 / 8e-58 unknown protein Potri.002G038200 [exp] 49 / 2e-08 AT2G20515 189 / 2e-62 unknown protein Potri.004G169200 [exp] 40 / 7e-05 AT2G16630 186 / 1e-55 Pollen Ole e 1 allergen and extensin family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10007352 pacid=23166201 polypeptide=Lus10007352 locus=Lus10007352.g ID=Lus10007352.BGIv1.0 annot-version=v1.0 ATGGGACTGCTAGGCTGGTGGGGTACAATGGGAAACGCATTCGGGGTCCCCAGCTTGCCAGGTTTTGGAGCCTCCACAAGTCTGCCGCAAGCTCTCTCCA ACACTCGAAGCGATGGCTACGGAGCGCTGTACAGGGAAGGCACAGCTGCACTGCTGAACTCGATGGTGAGTAACAGGTTTCCCTTCACAACCAACCAAGT GAGAGAGAGCTTCTTTTCAGCGCTGGGATCCAACAAGGCTGCTGCTTCTCAGGGGAAACTCTTCCAGATGGCAAATGAAGGACGACTCAAGCCCAGGAAT TAG
AA sequence Show only first row Show all	>Lus10007352 pacid=23166201 polypeptide=Lus10007352 locus=Lus10007352.g ID=Lus10007352.BGIv1.0 annot-version=v1.0 MGLLGWWGTMGNAFGVPSLPGFGASTSLPQALSNTRSDGYGALYREGTAALLNSMVSNRFPFTTNQVRESFFSALGSNKAAASQGKLFQMANEGRLKPRN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G42840		PDF1	protodermal factor 1 (.1)		Lus10007352 [exp]	0	1
AT3G54200			Late embryogenesis abundant (L...		Lus10007649 [exp]	1.0	0.9867
AT3G63480			ATP binding microtubule motor ...		Lus10035343 [exp]	2.4	0.9784
AT5G19260		FAF3	FANTASTIC FOUR 3, Protein of u...		Lus10042576 [exp]	2.6	0.9766
AT5G44940			F-box/RNI-like superfamily pro...		Lus10000726 [exp]	4.5	0.9817
AT1G79890			RAD3-like DNA-binding helicase...		Lus10037548 [exp]	4.5	0.9542
AT3G63480			ATP binding microtubule motor ...		Lus10035344 [exp]	4.7	0.9485
AT5G04530		KCS19	3-ketoacyl-CoA synthase 19 (.1...		Lus10040333 [exp]	5.3	0.9690
AT1G02335		GL22	germin-like protein subfamily ...		Lus10023350 [exp]	5.5	0.9817
AT3G26660	AS2	LBD24	LOB domain-containing protein ...		Lus10009567 [exp]	5.5	0.9676
AT1G51460		ABCG13	ATP-binding cassette G13, ABC-...		Lus10000339 [exp]	5.5	0.9736

Compare expression of checked genes

Lus10007352 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.