Lus10007539 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10012197 0 / 1 AT3G57500 68 / 6e-16 unknown protein
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10007539 pacid=23148075 polypeptide=Lus10007539 locus=Lus10007539.g ID=Lus10007539.BGIv1.0 annot-version=v1.0
ATGAGGAACTTGGAAGAAAGCAGCTGGCTAAACGGACTAGCGCCAGCGGCCGCAATGGAGCCGCCGGCAGAAGAGGGCGGAAATAGCAGACATTACACGG
GGAGATCAGTAGAGACGCTGGTGTTGTGCTGGCAGTTATCATCATCGCCGCAGTGTTTGCTGGATTCTTGGTTCGCTTATGTGCGGTCCACCGCAGCGGC
GAGCATGACGTCGTTGAAGGCAGCTGGATCGAGAGAAAGTGCCGGAGCTGCATCGACGGTGGGGTCGTGGCGGCTCGGCCTCCACCAGCACCGGAAGAGC
CAAAGAACCGTTGTGACCGTTGCCAAGATGCAATTGACTCGGTGA
AA sequence
>Lus10007539 pacid=23148075 polypeptide=Lus10007539 locus=Lus10007539.g ID=Lus10007539.BGIv1.0 annot-version=v1.0
MRNLEESSWLNGLAPAAAMEPPAEEGGNSRHYTGRSVETLVLCWQLSSSPQCLLDSWFAYVRSTAAASMTSLKAAGSRESAGAASTVGSWRLGLHQHRKS
QRTVVTVAKMQLTR

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10007539 0 1
AT2G33320 Calcium-dependent lipid-bindin... Lus10003570 2.6 0.6780
AT5G03620 Subtilisin-like serine endopep... Lus10035599 4.5 0.7080
AT1G66350 GRAS RGL1 RGA-like 1 (.1) Lus10041128 4.7 0.7161
AT2G45550 CYP76C4 "cytochrome P450, family 76, s... Lus10027430 9.2 0.7109
AT4G33985 Protein of unknown function (D... Lus10002400 9.2 0.7114
AT2G15130 Plant basic secretory protein ... Lus10026583 11.5 0.6967
AT1G23410 Ribosomal protein S27a / Ubiqu... Lus10013082 15.2 0.7143
Lus10039750 15.5 0.6660
Lus10002152 19.1 0.6502
Lus10010117 19.9 0.6502

Lus10007539 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.