Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G71150 105 / 2e-28 unknown protein AT1G22970 98 / 1e-25 unknown protein AT1G22980 84 / 1e-20 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10034613 [exp] 144 / 2e-43 AT1G71150 369 / 2e-127 unknown protein Lus10021799 [exp] 143 / 9e-43 AT1G71150 363 / 5e-125 unknown protein
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.008G126400 [exp] 130 / 6e-38 AT1G22970 363 / 7e-125 unknown protein Potri.010G117100 [exp] 61 / 3e-12 AT1G22970 283 / 2e-93 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10007947 pacid=23162293 polypeptide=Lus10007947 locus=Lus10007947.g ID=Lus10007947.BGIv1.0 annot-version=v1.0 ATGGCGAAATCGGAGAAAGATCGACTCCATCAAGCGCTATCTTCCCACCTCAGCACCATTAACGACACCTTACAGGTGTTGGATCAACCACTAGCTCTTT CTCTGGACAGAGTGAGCTGGGACGAGGTGATGAAGCTCGGCGACCAAGTCTACTGGCAAGCTACTATTGTTGGGGTGGTCTGGACAGGAGGCGGGAAGAT TGAAGCTAAAGCGATTGAAGAGAACATGGCGGCTTACTTCAATGCCCTGCAAGGGTTCCTTCTGATCTCTCATGGAAGCAGAGTCGGCACGGGCCGACTC TTGATTCGATGA
AA sequence Show only first row Show all	>Lus10007947 pacid=23162293 polypeptide=Lus10007947 locus=Lus10007947.g ID=Lus10007947.BGIv1.0 annot-version=v1.0 MAKSEKDRLHQALSSHLSTINDTLQVLDQPLALSLDRVSWDEVMKLGDQVYWQATIVGVVWTGGGKIEAKAIEENMAAYFNALQGFLLISHGSRVGTGRL LIR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G71150			unknown protein		Lus10007947 [exp]	0	1
AT4G30780			unknown protein		Lus10007704 [exp]	50.2	0.6228
AT3G61760		ADL1B	DYNAMIN-like 1B (.1)		Lus10030255 [exp]	52.8	0.6638
AT1G71692	MADS	XAL1, AGL12	XAANTAL1, AGAMOUS-like 12 (.1)		Lus10001277 [exp]	135.0	0.5847
AT1G06450			Polynucleotidyl transferase, r...		Lus10017895 [exp]	163.0	0.6116
AT4G05200		CRK25	cysteine-rich RLK (RECEPTOR-li...		Lus10003660 [exp]	198.3	0.5975
AT4G00440			Protein of unknown function (D...		Lus10036356 [exp]	206.7	0.5919
AT5G51280			DEAD-box protein abstrakt, put...		Lus10012899 [exp]	213.5	0.5702
AT1G08510		FATB	fatty acyl-ACP thioesterases B...		Lus10007942 [exp]	216.5	0.5889
AT3G07600			Heavy metal transport/detoxifi...		Lus10016063 [exp]	218.1	0.5732
AT4G39955			alpha/beta-Hydrolases superfam...		Lus10023147 [exp]	219.5	0.5717

Compare expression of checked genes

Lus10007947 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.