Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G23750 157 / 8e-50 Remorin family protein (.1.2) AT3G48940 139 / 7e-43 Remorin family protein (.1) AT3G61260 131 / 2e-39 Remorin family protein (.1) AT2G45820 117 / 4e-34 Remorin family protein (.1) AT1G63295 94 / 2e-25 Remorin family protein (.1) AT2G41870 76 / 2e-17 Remorin family protein (.1) AT3G57540 76 / 4e-17 Remorin family protein (.1) AT4G00670 67 / 4e-15 Remorin family protein (.1) AT2G02170 52 / 9e-09 Remorin family protein (.1.2) AT1G30320 52 / 2e-08 Remorin family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008477 [exp] 193 / 3e-63 AT5G23750 154 / 5e-47 Remorin family protein (.1.2) Lus10001477 [exp] 191 / 1e-62 AT5G23750 162 / 3e-50 Remorin family protein (.1.2) Lus10024514 [exp] 169 / 7e-55 AT5G23750 113 / 5e-32 Remorin family protein (.1.2) Lus10039215 [exp] 141 / 2e-43 AT3G61260 196 / 7e-64 Remorin family protein (.1) Lus10027460 [exp] 139 / 9e-43 AT3G61260 192 / 2e-62 Remorin family protein (.1) Lus10014785 [exp] 135 / 2e-41 AT3G61260 177 / 1e-56 Remorin family protein (.1) Lus10018840 [exp] 132 / 1e-39 AT3G61260 206 / 1e-67 Remorin family protein (.1) Lus10017811 [exp] 126 / 2e-37 AT3G61260 199 / 5e-65 Remorin family protein (.1) Lus10030379 [exp] 117 / 2e-34 AT3G61260 178 / 4e-57 Remorin family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G124400 [exp] 147 / 6e-46 AT5G23750 129 / 6e-38 Remorin family protein (.1.2) Potri.015G143600 [exp] 139 / 1e-42 AT5G23750 111 / 1e-30 Remorin family protein (.1.2) Potri.014G081300 [exp] 137 / 7e-42 AT3G61260 199 / 4e-65 Remorin family protein (.1) Potri.002G157700 [exp] 132 / 4e-40 AT3G61260 167 / 2e-52 Remorin family protein (.1) Potri.012G140800 [exp] 127 / 7e-38 AT5G23750 98 / 2e-25 Remorin family protein (.1.2) Potri.001G107000 [exp] 124 / 6e-37 AT5G23750 55 / 2e-09 Remorin family protein (.1.2) Potri.016G054400 [exp] 71 / 2e-15 AT2G41870 206 / 7e-66 Remorin family protein (.1) Potri.006G053200 [exp] 68 / 1e-14 AT3G57540 196 / 2e-61 Remorin family protein (.1) Potri.014G027900 [exp] 62 / 5e-12 AT1G45207 442 / 1e-149 Remorin family protein (.2) Potri.002G125200 [exp] 57 / 2e-10 AT1G45207 384 / 9e-127 Remorin family protein (.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF03763 [flax] [poplar] Remorin_C Remorin, C-terminal region
Representative CDS sequence Show only first row Show all	>Lus10008014 pacid=23161772 polypeptide=Lus10008014 locus=Lus10008014.g ID=Lus10008014.BGIv1.0 annot-version=v1.0 ATGCCAGACACTCGTCTAGATACTGTACTTGCCAGAGTTGAAACCGAGAAAAGAAACGCTTTGATCAGTGCATGGGAAGAAAATGAGAAGGCTAAAATAG ACAACAGGACTTACAAAAGGCTCTGTGCAATCACATCGTGGGAGAACACCAAGAAAGCAGCAGTAGAAGCGCAGATAAAGGAATACGAGGAGCACCTGCA GAAGAAGAGGGCTGAATATGTTGAGAGAACCCAAAACAAGCTAGCTGAAATTCATAAGGAAGCAGAGGAGAACAGGGCACTGACTGAAGCAAATAAAGGC CAAGAGTATGTGAAGATTGAGGAAACTGCAATCACATACAGAGCCACAGGGTACCCACCAAAGAAGTTATTCAGTTGCTTAGGTTGCTAA
AA sequence Show only first row Show all	>Lus10008014 pacid=23161772 polypeptide=Lus10008014 locus=Lus10008014.g ID=Lus10008014.BGIv1.0 annot-version=v1.0 MPDTRLDTVLARVETEKRNALISAWEENEKAKIDNRTYKRLCAITSWENTKKAAVEAQIKEYEEHLQKKRAEYVERTQNKLAEIHKEAEENRALTEANKG QEYVKIEETAITYRATGYPPKKLFSCLGC

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G23750			Remorin family protein (.1.2)		Lus10008014 [exp]	0	1
AT1G11920			Pectin lyase-like superfamily ...		Lus10018430 [exp]	16.2	0.7246
AT5G49350			Glycine-rich protein family (....		Lus10041125 [exp]	18.7	0.7300
AT5G37690			SGNH hydrolase-type esterase s...		Lus10039877 [exp]	18.8	0.7519
AT4G25850		ORP4B	OSBP(oxysterol binding protein...		Lus10019869 [exp]	19.4	0.5862
AT3G07840			Pectin lyase-like superfamily ...		Lus10009605 [exp]	20.2	0.6858
AT5G37690			SGNH hydrolase-type esterase s...		Lus10018641 [exp]	24.0	0.7479
AT1G11920			Pectin lyase-like superfamily ...		Lus10011258 [exp]	25.1	0.6967
AT5G22410		RHS18	root hair specific 18 (.1)		Lus10004859 [exp]	31.4	0.6888
AT1G30870			Peroxidase superfamily protein...		Lus10038393 [exp]	35.3	0.6787
AT3G18400	NAC	ANAC058	NAC domain containing protein ...		Lus10009669 [exp]	37.7	0.7147

Compare expression of checked genes

Lus10008014 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.