Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10010249 [exp] 107 / 2e-31 ND / Lus10021178 [exp] 107 / 1e-30 ND / Lus10004836 [exp] 107 / 1e-30 ND / Lus10000467 [exp] 106 / 1e-30 ND 37 / 0.005 Lus10010787 [exp] 104 / 1e-30 ND / Lus10011593 [exp] 103 / 5e-30 ND / Lus10021615 [exp] 104 / 7e-30 ND 41 / 1e-04 Lus10006939 [exp] 101 / 2e-29 ND / Lus10003310 [exp] 100 / 3e-29 ND /
Poplar homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10008049 pacid=23144284 polypeptide=Lus10008049 locus=Lus10008049.g ID=Lus10008049.BGIv1.0 annot-version=v1.0 ATGACGGCTTTATCCTTCTTCAGCACTCGTAGTGTGGTAGGAGCTGTTGGCGGTAATGCGTCTGCTGAGTACATGACGTGGTACCTCGACCGCACACCCA ACGATTGTCCCCATGCGCAAAATAGACGAGCCACATGCCCATTGGCACCCGAGCAGGCTATGCGTACTTTCTGCGCTGGCTTGGCACCCTTATACGAGTC TAGTGGAGTGGACGATTTGGTCGAGCGGGCTCAGGAGTACTACGAGATTGTTGAGGGCATGCGAGGGTTGTGGACTGAGTATGTCCGATAG
AA sequence Show only first row Show all	>Lus10008049 pacid=23144284 polypeptide=Lus10008049 locus=Lus10008049.g ID=Lus10008049.BGIv1.0 annot-version=v1.0 MTALSFFSTRSVVGAVGGNASAEYMTWYLDRTPNDCPHAQNRRATCPLAPEQAMRTFCAGLAPLYESSGVDDLVERAQEYYEIVEGMRGLWTEYVR

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10008049 [exp]	0	1
					Lus10010778 [exp]	3.2	1.0000
AT1G12570			Glucose-methanol-choline (GMC)...		Lus10002957 [exp]	3.5	1.0000
AT1G48120			hydrolases;protein serine/thre...		Lus10007708 [exp]	4.8	1.0000
AT3G20760			Nse4, component of Smc5/6 DNA ...		Lus10004185 [exp]	4.9	1.0000
AT5G52390			PAR1 protein (.1)		Lus10040715 [exp]	5.7	1.0000
					Lus10009800 [exp]	6.9	1.0000
AT4G01830		ABCB5, PGP5	ATP-binding cassette B5, P-gly...		Lus10004529 [exp]	8.7	1.0000
					Lus10011848 [exp]	10.4	1.0000
					Lus10011061 [exp]	10.7	1.0000
AT2G46760			D-arabinono-1,4-lactone oxidas...		Lus10012610 [exp]	10.8	0.8510

Compare expression of checked genes

Lus10008049 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.