Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G43990 40 / 0.0001 SDG18, SUVR2 SET DOMAIN PROTEIN 18, SET-domain containing protein lysine methyltransferase family protein (.1.2.3.4.5) AT1G04050 37 / 0.0008 SDG13, SUVR1 SET DOMAIN PROTEIN 13, homolog of SU(var)3-9 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10005476 [exp] 181 / 4e-56 AT3G04380 503 / 3e-176 SET DOMAIN PROTEIN 31, SET-domain containing protein lysine methyltransferase family protein (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G048100 [exp] 56 / 4e-10 AT3G04380 471 / 5e-161 SET DOMAIN PROTEIN 31, SET-domain containing protein lysine methyltransferase family protein (.1.2) Potri.002G257400 [exp] 43 / 1e-05 AT5G43990 524 / 8e-176 SET DOMAIN PROTEIN 18, SET-domain containing protein lysine methyltransferase family protein (.1.2.3.4.5) Potri.014G192500 [exp] 42 / 2e-05 AT5G43990 531 / 3e-178 SET DOMAIN PROTEIN 18, SET-domain containing protein lysine methyltransferase family protein (.1.2.3.4.5)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0214 [flax] [poplar] UBA PF10440 [flax] [poplar] WIYLD Ubiquitin-binding WIYLD domain
Representative CDS sequence Show only first row Show all	>Lus10008199 pacid=23173763 polypeptide=Lus10008199 locus=Lus10008199.g ID=Lus10008199.BGIv1.0 annot-version=v1.0 ATGGGAAGGGAAAGAGCTAGAAATGCACTTCGAGCCACAGAAGCTATGGGTTTACCTTCTAAAGAGGTGAAGAAAGTGCTGCTGAAGTTGCTGGAGACGT TTGATAAGAACTGGGACATGATTGAAGATGATGGCTACCGACTACTCGTGGACAGTTACTTTGAATCATTGGAGGAAACTAAAGTGTGTAGTCATGGATC TGCAGAAACTAAACCAACCAATGGTTCTAATGGTGATGCTGTGCAGTGGAAAATTCCCAGGACTGAAAAGGTTGAGCTGGTTAACGACCAAGCTTCTTGT GCTGCAATTCTTCTGCTGCAAACATGA
AA sequence Show only first row Show all	>Lus10008199 pacid=23173763 polypeptide=Lus10008199 locus=Lus10008199.g ID=Lus10008199.BGIv1.0 annot-version=v1.0 MGRERARNALRATEAMGLPSKEVKKVLLKLLETFDKNWDMIEDDGYRLLVDSYFESLEETKVCSHGSAETKPTNGSNGDAVQWKIPRTEKVELVNDQASC AAILLLQT

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G43990		SDG18, SUVR2	SET DOMAIN PROTEIN 18, SET-dom...		Lus10008199 [exp]	0	1

Compare expression of checked genes

Lus10008199 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.