Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G52590 261 / 5e-92 HAP4, ERD16, UBQ1, EMB2167 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) AT2G36170 261 / 5e-92 Ubiquitin supergroup;Ribosomal protein L40e (.1) AT4G05050 157 / 3e-50 UBQ11 ubiquitin 11 (.1.2.3.4) AT2G35635 156 / 6e-50 UBQ7, RUB2 RELATED TO UBIQUITIN 2, ubiquitin 7 (.1) AT1G23410 156 / 7e-50 Ribosomal protein S27a / Ubiquitin family protein (.1) AT1G31340 156 / 7e-50 NEDD8, ATRUB1, RUB1 ARABIDOPSIS THALIANA RELATED TO UBIQUITIN 1, related to ubiquitin 1 (.1) AT2G47110 156 / 8e-50 UBQ6 ubiquitin 6 (.1.2) AT3G62250 155 / 9e-50 UBQ5 ubiquitin 5 (.1) AT4G02890 157 / 3e-49 UBQ14 Ubiquitin family protein (.1.2.3.4) AT1G55060 155 / 1e-48 UBQ12 ubiquitin 12 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10030894 [exp] 156 / 6e-50 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10030595 [exp] 156 / 6e-50 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Lus10018367 [exp] 157 / 4e-49 AT4G05320 452 / 4e-164 polyubiquitin 10 (.1.2.3.4.5.6) Lus10022695 [exp] 123 / 9e-38 AT2G36170 120 / 3e-37 Ubiquitin supergroup;Ribosomal protein L40e (.1) Lus10023236 [exp] 86 / 3e-23 AT3G52590 84 / 1e-22 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Lus10014220 [exp] 76 / 4e-17 AT3G11510 236 / 4e-78 Ribosomal protein S11 family protein (.1) Lus10010493 [exp] 59 / 6e-11 AT4G12570 830 / 0.0 ubiquitin protein ligase 5 (.1) Lus10034563 [exp] 53 / 6e-09 AT5G42220 444 / 3e-148 Ubiquitin-like superfamily protein (.1) Lus10018538 [exp] 50 / 1e-08 AT2G35635 51 / 6e-09 RELATED TO UBIQUITIN 2, ubiquitin 7 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G077200 [exp] 262 / 3e-92 AT3G52590 260 / 2e-91 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.012G024300 [exp] 262 / 3e-92 AT3G52590 260 / 2e-91 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.015G007100 [exp] 262 / 3e-92 AT3G52590 260 / 2e-91 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.004G194000 [exp] 210 / 2e-71 AT3G52590 210 / 3e-71 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.016G077000 [exp] 196 / 2e-66 AT3G52590 194 / 1e-65 HAPLESS 4, EARLY-RESPONSIVE TO DEHYDRATION 16, EMBRYO DEFECTIVE 2167, ubiquitin extension protein 1 (.1) Potri.002G062500 [exp] 155 / 9e-50 AT1G31340 296 / 9e-105 ARABIDOPSIS THALIANA RELATED TO UBIQUITIN 1, related to ubiquitin 1 (.1) Potri.011G026600 [exp] 157 / 1e-49 AT4G05050 452 / 3e-164 ubiquitin 11 (.1.2.3.4) Potri.014G115100 [exp] 155 / 2e-49 AT2G47110 255 / 2e-88 ubiquitin 6 (.1.2) Potri.015G111500 [exp] 155 / 2e-49 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2) Potri.002G190000 [exp] 155 / 2e-49 AT2G47110 257 / 3e-89 ubiquitin 6 (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0072 [flax] [poplar] Ubiquitin PF00240 [flax] [poplar] ubiquitin Ubiquitin family CL0167 [flax] [poplar] Zn_Beta_Ribbon PF01020 [flax] [poplar] Ribosomal_L40e Ribosomal L40e family
Representative CDS sequence Show only first row Show all	>Lus10008873 pacid=23144212 polypeptide=Lus10008873 locus=Lus10008873.g ID=Lus10008873.BGIv1.0 annot-version=v1.0 ATGCAGATCTTCGTGAAAACCCTAACCGGCAAGACAATCACCCTCGAGGTGGAATCGAGCGATACCATCGATAATGTCAAGGCTAAGATTCAGGATAAGG AAGGTATTCCTCCGGATCAGCAGCGACTGATCTTCGCCGGGAAGCAGCTGGAAGATGGCCGTACTCTTGCTGATTACAATATCCAGAAAGAATCAACACT TCATTTGGTTCTGAGGCTTCGTGGTGGCATCATCGAGCCGTCGTTGATGGCATTGGCCAGGAAGTACAACCAAGATAAGATGATCTGCCGCAAGTGTTAT GCACGCCTCCACCCTCGAGCTGTCAACTGCAGGAAGAAGAAATGTGGACACAGCAACCAGCTGAGGCCAAAGAAGAAGATCAAGTAG
AA sequence Show only first row Show all	>Lus10008873 pacid=23144212 polypeptide=Lus10008873 locus=Lus10008873.g ID=Lus10008873.BGIv1.0 annot-version=v1.0 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGIIEPSLMALARKYNQDKMICRKCY ARLHPRAVNCRKKKCGHSNQLRPKKKIK

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G52590		HAP4, ERD16, UB...	HAPLESS 4, EARLY-RESPONSIVE TO...		Lus10008873 [exp]	0	1
AT5G27700			Ribosomal protein S21e (.1)		Lus10015173 [exp]	1.0	0.9752
AT3G61110		ARS27A	ribosomal protein S27 (.1)		Lus10031979 [exp]	1.7	0.9726
AT4G18100			Ribosomal protein L32e (.1)		Lus10009591 [exp]	2.4	0.9747
AT4G29410			Ribosomal L28e protein family ...		Lus10032699 [exp]	2.8	0.9703
AT1G13690		ATE1	ATPase E1 (.1)		Lus10004641 [exp]	3.6	0.9490
AT1G41880			Ribosomal protein L35Ae family...		Lus10028254 [exp]	3.9	0.9616
AT4G18100			Ribosomal protein L32e (.1)		Lus10020410 [exp]	6.0	0.9596
AT1G22780		RPS18A, PFL1, P...	40S RIBOSOMAL PROTEIN S18, POI...		Lus10042603 [exp]	6.9	0.9537
AT5G12110			Glutathione S-transferase, C-t...		Lus10036101 [exp]	9.2	0.9440
AT3G62870			Ribosomal protein L7Ae/L30e/S1...		Lus10035650 [exp]	9.5	0.9513

Compare expression of checked genes

Lus10008873 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.