Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G31790 103 / 2e-27 UDP-Glycosyltransferase superfamily protein (.1) AT1G05680 100 / 2e-26 UGT74E2 Uridine diphosphate glycosyltransferase 74E2 (.1) AT2G43820 100 / 2e-26 SGT1, ATSAGT1, GT, UGT74F2 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) AT1G05675 98 / 1e-25 UDP-Glycosyltransferase superfamily protein (.1) AT2G43840 94 / 5e-24 UGT74F1 UDP-glycosyltransferase 74 F1 (.1.2) AT1G24100 83 / 5e-20 UGT74B1 UDP-glucosyl transferase 74B1 (.1) AT2G31750 82 / 6e-20 UGT74D1 UDP-glucosyl transferase 74D1 (.1) AT4G14090 82 / 9e-20 UDP-Glycosyltransferase superfamily protein (.1) AT1G05530 82 / 1e-19 UGT75B2, UGT2 UDP-GLUCOSYL TRANSFERASE 2, UDP-glucosyl transferase 75B2 (.1) AT1G05560 80 / 6e-19 UGT75B1, UGT1 UDP-GLUCOSE TRANSFERASE 1, UDP-glucosyltransferase 75B1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10020556 [exp] 156 / 3e-47 AT2G43820 472 / 1e-164 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) Lus10009412 [exp] 150 / 4e-45 AT2G43820 474 / 1e-165 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) Lus10009417 [exp] 139 / 3e-43 AT1G05680 172 / 1e-51 Uridine diphosphate glycosyltransferase 74E2 (.1) Lus10006721 [exp] 92 / 2e-23 AT2G43820 392 / 9e-134 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) Lus10006351 [exp] 91 / 2e-23 AT1G05680 315 / 9e-106 Uridine diphosphate glycosyltransferase 74E2 (.1) Lus10008742 [exp] 89 / 2e-22 AT2G43840 478 / 6e-167 UDP-glycosyltransferase 74 F1 (.1.2) Lus10006352 [exp] 89 / 3e-22 AT2G43820 414 / 6e-142 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) Lus10024118 [exp] 88 / 8e-22 AT1G05675 375 / 2e-126 UDP-Glycosyltransferase superfamily protein (.1) Lus10020559 [exp] 87 / 2e-21 AT2G43820 436 / 3e-150 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G140500 [exp] 113 / 4e-31 AT2G43840 463 / 3e-161 UDP-glycosyltransferase 74 F1 (.1.2) Potri.017G032500 [exp] 106 / 1e-28 AT1G05680 446 / 1e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032300 [exp] 105 / 2e-28 AT1G05675 465 / 6e-162 UDP-Glycosyltransferase superfamily protein (.1) Potri.007G141700 [exp] 100 / 6e-28 AT1G05680 237 / 4e-77 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.001G389200 [exp] 104 / 9e-28 AT1G05680 494 / 2e-173 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.004G179300 [exp] 103 / 1e-27 AT1G05680 446 / 1e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032733 [exp] 102 / 6e-27 AT1G05680 444 / 6e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032700 [exp] 102 / 6e-27 AT1G05680 444 / 6e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.007G140300 [exp] 99 / 5e-26 AT1G05680 457 / 4e-159 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.007G117200 [exp] 96 / 1e-24 AT2G43840 461 / 1e-160 UDP-glycosyltransferase 74 F1 (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10009408 pacid=23142603 polypeptide=Lus10009408 locus=Lus10009408.g ID=Lus10009408.BGIv1.0 annot-version=v1.0 ATGCCGCAGTGGGCAGACCAGCCACCCAACGCGATGCTTGTCGAGCGAGTTTGGAAGATTGGGGTTAGGGGTACGGTCGGGGCGGATGGGATTGTGAGTG GGAATGAAGTGGAGAGATGTGTGAGGGAAGTGATGGAAGGTGAAAGAGGGAAGGAAATGAGGAGCAATTTTGAGAAGTGGAAGGATTTGGCTTGCTTGGC TATTAGTGAAGGTGGATCTTCTGATACGAGTATTGATAAGTTTGTATCAGAATTGGAGAGTGACCAAAGTCATTAG
AA sequence Show only first row Show all	>Lus10009408 pacid=23142603 polypeptide=Lus10009408 locus=Lus10009408.g ID=Lus10009408.BGIv1.0 annot-version=v1.0 MPQWADQPPNAMLVERVWKIGVRGTVGADGIVSGNEVERCVREVMEGERGKEMRSNFEKWKDLACLAISEGGSSDTSIDKFVSELESDQSH

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G05680		UGT74E2	Uridine diphosphate glycosyltr...		Lus10009408 [exp]	0	1
					Lus10006537 [exp]	4.0	0.7330
					Lus10027893 [exp]	5.9	0.8362
AT1G55570		SKS12	SKU5 similar 12 (.1)		Lus10021864 [exp]	9.2	0.8345
AT4G33030		SQD1	sulfoquinovosyldiacylglycerol ...		Lus10032973 [exp]	11.1	0.8015
AT2G04160		AIR3	AUXIN-INDUCED IN ROOT CULTURES...		Lus10027895 [exp]	12.7	0.7697
AT5G67360		ARA12	Subtilase family protein (.1)		Lus10002393 [exp]	14.1	0.7831
AT4G36470			S-adenosyl-L-methionine-depend...		Lus10028330 [exp]	23.6	0.7877
AT2G37890			Mitochondrial substrate carrie...		Lus10016522 [exp]	28.5	0.7385
AT1G14830		DRP1C, ADL5, AD...	DYNAMIN RELATED PROTEIN 1C, AR...		Lus10043352 [exp]	31.7	0.7720
AT1G24430			HXXXD-type acyl-transferase fa...		Lus10006219 [exp]	31.9	0.6936

Compare expression of checked genes

Lus10009408 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.