Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G01360 157 / 7e-50 PYL9, RCAR1 PYRABACTIN RESISTANCE 1-LIKE 9, regulatory component of ABA receptor 1 (.1) AT5G53160 155 / 8e-50 RCAR3, PYL8 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) AT4G27920 154 / 4e-49 RCAR4, PYL10 regulatory components of ABA receptor 4, PYR1-like 10 (.1) AT4G01026 150 / 3e-47 RCAR2, PYL7 regulatory components of ABA receptor 2, PYR1-like 7 (.1) AT2G38310 105 / 1e-29 RCAR10, PYL4 regulatory components of ABA receptor 10, PYR1-like 4 (.1) AT5G05440 105 / 3e-29 RCAR8, PYL5 regulatory component of ABA receptor 8, PYRABACTIN RESISTANCE 1-LIKE 5, Polyketide cyclase/dehydrase and lipid transport superfamily protein (.1) AT5G45860 100 / 4e-28 RCAR5, PYL11 regulatory components of ABA receptor 5, PYR1-like 11 (.1) AT2G26040 101 / 5e-28 RCAR14, PYL2 regulatory components of ABA receptor 14, PYR1-like 2 (.1) AT4G17870 96 / 5e-26 RCAR11, PYR1 regulatory component of ABA receptor 11, PYRABACTIN RESISTANCE 1, Polyketide cyclase/dehydrase and lipid transport superfamily protein (.1) AT5G45870 94 / 2e-25 RCAR6, PYL12 regulatory components of ABA receptor 6, PYR1-like 12 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10040916 [exp] 240 / 8e-83 AT1G01360 265 / 1e-91 PYRABACTIN RESISTANCE 1-LIKE 9, regulatory component of ABA receptor 1 (.1) Lus10001059 [exp] 155 / 3e-49 AT5G53160 306 / 1e-107 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Lus10039335 [exp] 147 / 1e-45 AT5G53160 295 / 4e-103 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Lus10014929 [exp] 147 / 2e-45 AT5G53160 289 / 2e-100 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Lus10038818 [exp] 145 / 9e-45 AT5G53160 287 / 1e-99 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Lus10014239 [exp] 107 / 4e-30 AT2G38310 250 / 5e-85 regulatory components of ABA receptor 10, PYR1-like 4 (.1) Lus10022675 [exp] 108 / 1e-29 AT2G38310 249 / 1e-83 regulatory components of ABA receptor 10, PYR1-like 4 (.1) Lus10026430 [exp] 102 / 6e-28 AT2G26040 264 / 1e-90 regulatory components of ABA receptor 14, PYR1-like 2 (.1) Lus10024991 [exp] 101 / 8e-28 AT2G26040 264 / 7e-91 regulatory components of ABA receptor 14, PYR1-like 2 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G169400 [exp] 179 / 7e-59 AT1G01360 305 / 2e-107 PYRABACTIN RESISTANCE 1-LIKE 9, regulatory component of ABA receptor 1 (.1) Potri.014G097100 [exp] 176 / 2e-57 AT1G01360 301 / 6e-106 PYRABACTIN RESISTANCE 1-LIKE 9, regulatory component of ABA receptor 1 (.1) Potri.001G092500 [exp] 159 / 7e-51 AT5G53160 296 / 7e-104 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Potri.003G139200 [exp] 158 / 3e-50 AT5G53160 297 / 3e-104 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Potri.015G020500 [exp] 157 / 4e-50 AT5G53160 304 / 7e-107 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Potri.012G000800 [exp] 155 / 3e-49 AT5G53160 303 / 1e-106 PYR1-like 8, regulatory components of ABA receptor 3 (.1.2) Potri.008G073400 [exp] 108 / 2e-30 AT2G38310 229 / 2e-76 regulatory components of ABA receptor 10, PYR1-like 4 (.1) Potri.018G054400 [exp] 107 / 3e-30 AT2G26040 273 / 1e-94 regulatory components of ABA receptor 14, PYR1-like 2 (.1) Potri.010G183900 [exp] 107 / 3e-30 AT2G40330 243 / 8e-82 regulatory components of ABA receptor 9, PYR1-like 6 (.1) Potri.006G230600 [exp] 106 / 5e-30 AT2G26040 266 / 6e-92 regulatory components of ABA receptor 14, PYR1-like 2 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0209 [flax] [poplar] Bet_v_1_like PF10604 [flax] [poplar] Polyketide_cyc2 Polyketide cyclase / dehydrase and lipid transport
Representative CDS sequence Show only first row Show all	>Lus10009812 pacid=23180189 polypeptide=Lus10009812 locus=Lus10009812.g ID=Lus10009812.BGIv1.0 annot-version=v1.0 ATGACCATCATCAATGGCGATTGCGGCAGCGCATTGGAGGCGCAGTACATCTGGATGCACCATCGCCACCAGACGGCCGATAATCAGTCCTCTTCTAACT GTTCTTCTAACCTCGTCACGCACATCAAAGCCCCCGTCGACATCGTATGGTCTCTGGTGAGGCGATTCGACGAGCCACAGACTTACAAGCCATTCATAAG CAGGTGTGTTATGAATGGCGAAGTTGGGATTGGAAGTCTCAGACATGTGAATGTCAGGTCTGGACTCCCTGCAACCACCAGCACTGAAAGATTGGAGCTC TTCGATGATGAAGAACACATCCTCGGTATCAAGATCGTCGATGGTGATCACCGGCTAAAGGTAAATTAA
AA sequence Show only first row Show all	>Lus10009812 pacid=23180189 polypeptide=Lus10009812 locus=Lus10009812.g ID=Lus10009812.BGIv1.0 annot-version=v1.0 MTIINGDCGSALEAQYIWMHHRHQTADNQSSSNCSSNLVTHIKAPVDIVWSLVRRFDEPQTYKPFISRCVMNGEVGIGSLRHVNVRSGLPATTSTERLEL FDDEEHILGIKIVDGDHRLKVN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G01360		PYL9, RCAR1	PYRABACTIN RESISTANCE 1-LIKE 9...		Lus10009812 [exp]	0	1
AT1G01360		PYL9, RCAR1	PYRABACTIN RESISTANCE 1-LIKE 9...		Lus10040916 [exp]	1.0	0.9329
AT3G52060			Core-2/I-branching beta-1,6-N-...		Lus10028866 [exp]	4.2	0.9040
					Lus10020006 [exp]	5.5	0.9059
AT5G03110			unknown protein		Lus10019920 [exp]	6.3	0.9023
AT5G67020			unknown protein		Lus10019345 [exp]	10.5	0.8955
AT1G01470		LSR3, LEA14	LIGHT STRESS-REGULATED 3, LATE...		Lus10007905 [exp]	13.0	0.8954
AT3G26330		CYP71B37	"cytochrome P450, family 71, s...		Lus10016599 [exp]	16.7	0.8902
AT4G14540	CCAAT	NF-YB3	"nuclear factor Y, subunit B3"...		Lus10016616 [exp]	17.9	0.8802
AT5G44060			unknown protein		Lus10003619 [exp]	18.7	0.8647
AT1G65720			unknown protein		Lus10031363 [exp]	20.2	0.8837

Compare expression of checked genes

Lus10009812 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.