Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G51770 164 / 4e-48 ATEOL1, ETO1 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) AT5G58550 100 / 1e-25 EOL2 ETO1-like 2 (.1.2) AT4G02680 63 / 2e-12 EOL1 ETO1-like 1 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10012472 [exp] 198 / 7e-66 AT3G51770 230 / 2e-70 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Lus10002206 [exp] 155 / 6e-45 AT3G51770 1089 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Lus10022660 [exp] 153 / 5e-44 AT3G51770 1231 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Lus10012238 [exp] 143 / 1e-40 AT3G51770 1092 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Lus10031289 [exp] 100 / 3e-25 AT3G51770 1083 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Lus10031859 [exp] 97 / 2e-24 AT3G51770 1088 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Lus10022084 [exp] 58 / 1e-10 AT4G02680 1267 / 0.0 ETO1-like 1 (.1) Lus10026455 [exp] 45 / 8e-07 AT3G51770 63 / 2e-12 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G123800 [exp] 157 / 2e-45 AT3G51770 1415 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Potri.006G103400 [exp] 144 / 4e-41 AT3G51770 1399 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Potri.001G280100 [exp] 126 / 1e-34 AT3G51770 1192 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Potri.009G075300 [exp] 121 / 6e-33 AT3G51770 1206 / 0.0 ARABIDOPSIS ETHYLENE OVERPRODUCER 1, tetratricopeptide repeat (TPR)-containing protein (.1), tetratricopeptide repeat (TPR)-containing protein (.2) Potri.002G048300 [exp] 52 / 2e-08 AT4G02680 1293 / 0.0 ETO1-like 1 (.1) Potri.005G214400 [exp] 49 / 2e-07 AT4G02680 1264 / 0.0 ETO1-like 1 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10010040 pacid=23155621 polypeptide=Lus10010040 locus=Lus10010040.g ID=Lus10010040.BGIv1.0 annot-version=v1.0 ATGCTCCGGTGGAGCCTCCGTTCGGCTCGGCAACACGCCGTCGATGTCCACTCCAAAATCGTGCTCGCTTCCTGGCTGAGATTCGAGATGAGAGAAGACG AGCTGATCGGTACTTCGGCGATGGATTGTTGTGGGAGAAATATCAAATGCCCAAGGTCATGCTTGATTTCTGGTTACGATCCTGAATGTGCAAATGATCC TTGCAGGTGTTCTTCACGATATGACAGCGATGATGTTGAATTGATCGGAGAGGAATGTTCGACTTCCTCCGACGACGAAGCGGATATTTTGTTATGCATT AGCGAAGAAGAAATTCATTGCAATATGTACAAGATCGCATCGATTTCTAGGCCATTTAAGGAAATGCTTTATTGA
AA sequence Show only first row Show all	>Lus10010040 pacid=23155621 polypeptide=Lus10010040 locus=Lus10010040.g ID=Lus10010040.BGIv1.0 annot-version=v1.0 MLRWSLRSARQHAVDVHSKIVLASWLRFEMREDELIGTSAMDCCGRNIKCPRSCLISGYDPECANDPCRCSSRYDSDDVELIGEECSTSSDDEADILLCI SEEEIHCNMYKIASISRPFKEMLY

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G51770		ATEOL1, ETO1	ARABIDOPSIS ETHYLENE OVERPRODU...		Lus10010040 [exp]	0	1
AT3G19300			Protein kinase superfamily pro...		Lus10034770 [exp]	1.4	0.7910
					Lus10015249 [exp]	11.3	0.7217
AT3G62830		ATUXS2, UXS2, A...	UDP-GLUCURONIC ACID DECARBOXYL...		Lus10006510 [exp]	12.2	0.7389
AT2G39040			Peroxidase superfamily protein...		Lus10021956 [exp]	12.6	0.7681
AT3G12120		FAD2	fatty acid desaturase 2 (.1.2)		Lus10021046 [exp]	15.1	0.6860
AT5G44390			FAD-binding Berberine family p...		Lus10026775 [exp]	21.5	0.7844
AT1G47960		ATC/VIF1, C/VIF...	cell wall / vacuolar inhibitor...		Lus10027947 [exp]	23.9	0.6536
AT4G12520			Bifunctional inhibitor/lipid-t...		Lus10004347 [exp]	24.0	0.6840
AT4G05030			Copper transport protein famil...		Lus10016059 [exp]	26.4	0.7297
AT5G67360		ARA12	Subtilase family protein (.1)		Lus10027896 [exp]	28.2	0.6351

Compare expression of checked genes

Lus10010040 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.