Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G08290 86 / 9e-23 YLS8 YELLOW-LEAF-SPECIFIC GENE 8, mRNA splicing factor, thioredoxin-like U5 snRNP (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10017390 [exp] 91 / 2e-24 AT5G08290 290 / 1e-102 YELLOW-LEAF-SPECIFIC GENE 8, mRNA splicing factor, thioredoxin-like U5 snRNP (.1) Lus10010188 [exp] 86 / 1e-22 AT5G08290 293 / 4e-104 YELLOW-LEAF-SPECIFIC GENE 8, mRNA splicing factor, thioredoxin-like U5 snRNP (.1) Lus10022811 [exp] 39 / 0.0001 AT3G24730 261 / 7e-91 mRNA splicing factor, thioredoxin-like U5 snRNP (.1) Lus10011878 [exp] 39 / 0.0001 AT3G24730 258 / 1e-89 mRNA splicing factor, thioredoxin-like U5 snRNP (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G072700 [exp] 90 / 3e-24 AT5G08290 293 / 5e-104 YELLOW-LEAF-SPECIFIC GENE 8, mRNA splicing factor, thioredoxin-like U5 snRNP (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0172 [flax] [poplar] Thioredoxin PF02966 [flax] [poplar] DIM1 Mitosis protein DIM1
Representative CDS sequence Show only first row Show all	>Lus10010189 pacid=23154203 polypeptide=Lus10010189 locus=Lus10010189.g ID=Lus10010189.BGIv1.0 annot-version=v1.0 ATGTCGTACCTGCTACCGCACCTGCACTCGGGATGGGCGGTGGATCAGGCGATCCTGGCGGAGGAGGAGCGGGTCGTCGTCATCCGGTTCGGCCACGACT GGGACGACACTTGTATGCAGGCAATCAATCTCCGATCTCTGCTTTCTGATGGTATCTCCGATCAATGCAATTGCGATCGAGCGTTATTGCTTTGTTTGTT TTGTTTGCCCGTTTATGAAATCCTAGCTCTTGAATCTTTAGGCACCGATCGATTTTTTCACCGGAGTCCACCGATTTGGGATTATTACGATGATGATCAT GAGTTTGAATTTGAAACCTGA
AA sequence Show only first row Show all	>Lus10010189 pacid=23154203 polypeptide=Lus10010189 locus=Lus10010189.g ID=Lus10010189.BGIv1.0 annot-version=v1.0 MSYLLPHLHSGWAVDQAILAEEERVVVIRFGHDWDDTCMQAINLRSLLSDGISDQCNCDRALLLCLFCLPVYEILALESLGTDRFFHRSPPIWDYYDDDH EFEFET

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G08290		YLS8	YELLOW-LEAF-SPECIFIC GENE 8, m...		Lus10010189 [exp]	0	1
AT3G13130			unknown protein		Lus10039066 [exp]	1.4	0.8860
AT5G37670		HSP15.7CI	HSP20-like chaperones superfam...		Lus10020815 [exp]	7.6	0.8600
AT2G29500			HSP20-like chaperones superfam...		Lus10040723 [exp]	7.7	0.8109
AT5G13490		AAC2	ADP/ATP carrier 2 (.1.2)		Lus10031843 [exp]	8.7	0.8570
AT4G02450			HSP20-like chaperones superfam...		Lus10000340 [exp]	11.5	0.8553
AT5G02490		AtHsp70-2	Heat shock protein 70 (Hsp 70)...		Lus10040304 [exp]	12.0	0.8080
AT2G38860		YLS5	Class I glutamine amidotransfe...		Lus10014721 [exp]	13.0	0.8136
AT1G07400			HSP20-like chaperones superfam...		Lus10040722 [exp]	14.3	0.8516
AT1G24140			Matrixin family protein (.1)		Lus10005605 [exp]	19.4	0.8239
AT1G16810			unknown protein		Lus10026960 [exp]	19.6	0.8248

Compare expression of checked genes

Lus10010189 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.