Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G23940 40 / 3e-05 Protein of unknown function (DUF788) (.1) AT4G30500 37 / 0.0006 Protein of unknown function (DUF788) (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10041903 [exp] 60 / 2e-12 AT2G23940 295 / 1e-103 Protein of unknown function (DUF788) (.1) Lus10028450 [exp] 57 / 2e-11 AT2G23940 295 / 5e-104 Protein of unknown function (DUF788) (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.018G101100 [exp] 46 / 2e-07 AT2G23940 228 / 4e-77 Protein of unknown function (DUF788) (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10010382 pacid=23146094 polypeptide=Lus10010382 locus=Lus10010382.g ID=Lus10010382.BGIv1.0 annot-version=v1.0 ATGGCAAATCAGGGAGCTAAGAAGCGTTATATATGTGTTGGTGAGGCTGCTGATATTCCTTTCGAGTTTCACATGGAAGCACGGGATTGGCCTGGTATTG ACTGCTCTGGCATATTACTTCCTTACCAACAACTTGCTTCCATGGCCAAACCTATCTATGGAGATAACGGGGAGCTTTTCGATGGTGGTTTATTGGGGAC CTTTTCGATGGTGGCATTTGTGGGTAACAATTTGATGCATTCAAAATCAAACACCAATAAGGAACAAATTGATTACTGA
AA sequence Show only first row Show all	>Lus10010382 pacid=23146094 polypeptide=Lus10010382 locus=Lus10010382.g ID=Lus10010382.BGIv1.0 annot-version=v1.0 MANQGAKKRYICVGEAADIPFEFHMEARDWPGIDCSGILLPYQQLASMAKPIYGDNGELFDGGLLGTFSMVAFVGNNLMHSKSNTNKEQIDY

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
					Lus10010382 [exp]	0	1
AT1G06930			unknown protein		Lus10014158 [exp]	15.7	0.7748
AT2G29570		ATPCNA2, PCNA2	A. THALIANA PROLIFERATING CELL...		Lus10038360 [exp]	29.5	0.6917
AT2G30395	OFP	ATOFP17, OFP17	ovate family protein 17 (.1)		Lus10008588 [exp]	30.6	0.6994
AT1G72490			unknown protein		Lus10008123 [exp]	102.4	0.6860
					Lus10010622 [exp]	111.0	0.6959

Compare expression of checked genes

Lus10010382 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.